ID: 931762459

View in Genome Browser
Species Human (GRCh38)
Location 2:65430688-65430710
Sequence CCCTCCAGGGCGCGTCCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931762447_931762459 11 Left 931762447 2:65430654-65430676 CCCACACTCCCCTGCAAAGACGC 0: 1
1: 0
2: 1
3: 9
4: 127
Right 931762459 2:65430688-65430710 CCCTCCAGGGCGCGTCCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 126
931762446_931762459 17 Left 931762446 2:65430648-65430670 CCGAAGCCCACACTCCCCTGCAA 0: 1
1: 0
2: 3
3: 22
4: 309
Right 931762459 2:65430688-65430710 CCCTCCAGGGCGCGTCCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 126
931762451_931762459 3 Left 931762451 2:65430662-65430684 CCCCTGCAAAGACGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 931762459 2:65430688-65430710 CCCTCCAGGGCGCGTCCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 126
931762454_931762459 1 Left 931762454 2:65430664-65430686 CCTGCAAAGACGCGCGCGGGGCC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 931762459 2:65430688-65430710 CCCTCCAGGGCGCGTCCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 126
931762453_931762459 2 Left 931762453 2:65430663-65430685 CCCTGCAAAGACGCGCGCGGGGC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 931762459 2:65430688-65430710 CCCTCCAGGGCGCGTCCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 126
931762448_931762459 10 Left 931762448 2:65430655-65430677 CCACACTCCCCTGCAAAGACGCG 0: 1
1: 0
2: 0
3: 10
4: 95
Right 931762459 2:65430688-65430710 CCCTCCAGGGCGCGTCCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 126
931762445_931762459 21 Left 931762445 2:65430644-65430666 CCTTCCGAAGCCCACACTCCCCT 0: 1
1: 0
2: 4
3: 20
4: 255
Right 931762459 2:65430688-65430710 CCCTCCAGGGCGCGTCCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931762459 Original CRISPR CCCTCCAGGGCGCGTCCCCG CGG Intronic
900148851 1:1169593-1169615 CCCTCCAGGGCCCATCTCTGGGG + Intergenic
900382599 1:2392139-2392161 CCGTCCCGGGCCCGACCCCGAGG - Intronic
901373084 1:8817289-8817311 CCCTCCGCGTCGCCTCCCCGCGG - Exonic
901399261 1:9004865-9004887 CCCTCCAGGTCCTGTCCCCTCGG - Exonic
901526114 1:9824187-9824209 CCACCCCAGGCGCGTCCCCGCGG - Exonic
901793029 1:11664416-11664438 GCGCCCAGGTCGCGTCCCCGGGG + Intronic
905283257 1:36862658-36862680 TCCTCCAGGGCGGCTCCCTGAGG + Intronic
905862743 1:41361834-41361856 CCCTCCCGCGGGCCTCCCCGGGG + Intergenic
906279261 1:44542545-44542567 CCCTCCACAGCGTGTCCCCAGGG + Intronic
915326166 1:155082222-155082244 CCCTCTAGCGCGCGCCCCCGAGG - Intronic
921907631 1:220511990-220512012 CCCTCCAGGGGCCGTCACAGTGG - Intergenic
923631069 1:235649849-235649871 CCCTGCAGGGCCCGACCACGCGG + Exonic
923631386 1:235650727-235650749 CTCTCCAGGCCTCGTCCCTGTGG + Intronic
924199057 1:241640506-241640528 CCCCCGCGGGCGCGTCCTCGCGG + Intronic
924482743 1:244451738-244451760 CGCCCCAGGGCGCGGCCCGGAGG - Exonic
1067028641 10:42865879-42865901 CCCTTCAGGGGGCGTCCATGGGG + Intergenic
1070290759 10:75111813-75111835 CCCTCCAGGTCGCGGTCCCTCGG - Intronic
1076156810 10:128210993-128211015 GCCTCCAGGGCGCCTCCCCCGGG + Intergenic
1076371902 10:129960452-129960474 CGCTGCAGGGCGCGTGGCCGCGG + Intronic
1076885704 10:133261513-133261535 ACCCCCTGGGAGCGTCCCCGTGG - Intergenic
1076915980 10:133423377-133423399 TCCTCCAGGCCGCGTTCCCCGGG + Exonic
1076936116 10:133568243-133568265 TCCTCCAGGCCGCGTTCCCCGGG + Intronic
1078085485 11:8231036-8231058 CCCTCCTGGGAGTGTCCCAGGGG - Intronic
1083654979 11:64225234-64225256 TCCTCCAGGGCTCGCCCTCGGGG + Intronic
1084259456 11:67966052-67966074 CCCTGCAGGGCCCGACCCCCTGG - Intergenic
1090239758 11:125173791-125173813 CCCTCGGGGGCTCGTGCCCGTGG + Intronic
1096510417 12:52124905-52124927 ACCTCCAGGGAGCCTCCCCATGG - Intergenic
1102430491 12:112879372-112879394 TCCTCCAGGGATCGTCCCAGAGG + Intronic
1104967050 12:132513015-132513037 CCCACCAGGGCGCGGGCCCCAGG - Intronic
1107975905 13:45688382-45688404 CCCTCCAGGCCAGGTCACCGAGG - Intergenic
1113795575 13:113055876-113055898 CCCTCCAGAGCACTTCCCTGGGG + Intronic
1113811673 13:113146431-113146453 CCCTCCAGGGCGCCCCACCCTGG - Intronic
1114265372 14:21070227-21070249 CCCTCCCTGGCGGGGCCCCGCGG + Intronic
1120993635 14:90398364-90398386 CCGGGCAGGGCGCGTGCCCGGGG - Intronic
1122542709 14:102506998-102507020 CTCTCCAGGCCGCTTCCCCGAGG - Exonic
1126678722 15:51184071-51184093 CGCTCTAGGACCCGTCCCCGGGG + Intergenic
1128061966 15:64740986-64741008 CCCTCCAGGTCTGGTCACCGGGG - Exonic
1128545030 15:68561073-68561095 CCCTCCACCCCGCGTCCCCCAGG + Intergenic
1129826981 15:78640805-78640827 CCCTCCAGGGCGAGTGTCTGTGG - Intronic
1130552042 15:84895454-84895476 CCCTCCAGGGATGGTCCCTGCGG - Intronic
1131184936 15:90265928-90265950 CGCTCCAGGCCGCGCCCCCTTGG + Intronic
1131215338 15:90530683-90530705 CCATCCAGGGCCCGGCCCTGGGG + Intronic
1132717816 16:1300986-1301008 CCCTCCCGGGGGCGGCCCCACGG + Intergenic
1132929407 16:2451256-2451278 CCCTTCAGGGAGCGTAGCCGGGG + Intronic
1134419404 16:14071590-14071612 CGCGCCCGGGCGCGACCCCGGGG + Intronic
1137926584 16:52546942-52546964 CCCGGCGGGGCGCGTCCCCCCGG - Exonic
1138399044 16:56730612-56730634 CCCTACAGGGTGTGTCCACGAGG - Intronic
1142282216 16:89154528-89154550 CTCTCCAGGGCAGGTCCCAGAGG + Exonic
1142693607 17:1621374-1621396 CCCTCCAGGGTGCGGGCCCCTGG + Intronic
1145909343 17:28533515-28533537 CCCACCAGGGCACGCCCCCTGGG + Intronic
1146053422 17:29569081-29569103 CCCTCCAGGGCTCCTACCTGCGG - Exonic
1146759071 17:35460473-35460495 CGCCCCAGGGCGCGGCCCAGAGG - Intergenic
1147643161 17:42017491-42017513 CCCTTCTGGGCGCGGCGCCGCGG - Exonic
1147900296 17:43779093-43779115 CACTCCTGGGCGCGTCCCGGGGG + Intergenic
1151579870 17:74971935-74971957 CTCTCCAGGGGCCTTCCCCGAGG - Intronic
1151658180 17:75505262-75505284 GCCTCCAGGGCGAGCCCCAGTGG + Intronic
1152079324 17:78176716-78176738 CCCTCCAGGGGGCGCGCCCCTGG - Intronic
1152739138 17:82011437-82011459 CCCTCCTGGGCCTTTCCCCGAGG - Intronic
1153031079 18:712959-712981 CCCTCTAGGGCGCGGCTCCCGGG - Intergenic
1157752814 18:50194297-50194319 CTCTCGAGGGCGCGCCTCCGAGG - Intronic
1160875199 19:1293597-1293619 CCCTCCAGGCCTGGTGCCCGGGG + Intronic
1161019242 19:2000236-2000258 CCCTCCTGGCCGCGTCCTCAAGG + Intronic
1161313310 19:3606776-3606798 CCCTCCAGGCCGCGACCCCAGGG - Intronic
1161701939 19:5800500-5800522 CCCCACAGGGCTGGTCCCCGGGG + Intergenic
1162067405 19:8134500-8134522 CCCCCCAGGGCCCCTCCCTGGGG + Intronic
1162915687 19:13873288-13873310 CTCTCGGGGGCGCGTCCTCGGGG + Intronic
1164627136 19:29737279-29737301 GCCTCCATGTCCCGTCCCCGGGG + Intergenic
1167389279 19:49183128-49183150 CGCTCCAGGGGGCCTGCCCGAGG - Exonic
927572831 2:24175096-24175118 CGCTCCAGGACGCGGCCTCGGGG + Exonic
927572888 2:24175237-24175259 TCCTCCGGGGCGCGCCCCCCTGG - Intronic
931762459 2:65430688-65430710 CCCTCCAGGGCGCGTCCCCGCGG + Intronic
932331619 2:70901234-70901256 CCCTCCACGTCCTGTCCCCGCGG - Intronic
938310870 2:130287418-130287440 CCCTGCCGGGCGCGCCCCCTGGG - Intergenic
939153807 2:138501762-138501784 CCCGCGAGGGCGCGTGCGCGCGG - Intergenic
947523372 2:230864869-230864891 CCCTCCCCGCCCCGTCCCCGCGG - Intronic
1171382862 20:24746407-24746429 CCCTCCAGGCCTCCTCACCGGGG + Intergenic
1171435286 20:25117417-25117439 CCCTCCTCGGCCCATCCCCGAGG + Intergenic
1178953959 21:37006829-37006851 GCCTCCAGGGAGCGTCCCCGGGG - Exonic
1179972261 21:44842713-44842735 GCTTCCAGGGCGCGTGCCCTAGG - Intergenic
1180782694 22:18529741-18529763 ACCGCCAGGACGCCTCCCCGAGG + Intronic
1180801429 22:18633885-18633907 CCCTCCACGGTGCGTCGCCTGGG + Intergenic
1180852663 22:19029425-19029447 CCCTCCACGGTGCGTCGCCTGGG + Intergenic
1180951704 22:19723414-19723436 CGCTGCAGCGCGCGTCCGCGCGG + Exonic
1181126254 22:20703768-20703790 ACCGCCAGGACGCCTCCCCGAGG + Intergenic
1181220292 22:21361376-21361398 CCCTCCACGGTGCGTCGCCTGGG - Intergenic
1181239584 22:21469079-21469101 ACCGCCAGGACGCCTCCCCGAGG + Intergenic
1182237133 22:28884233-28884255 GCCTCCGGGGCGCATCCGCGGGG + Intronic
1182844264 22:33417675-33417697 CCATCCAGGGCTCTTGCCCGGGG + Intronic
1183314623 22:37129984-37130006 CTCTCCAGGGAGAGTCCCTGAGG + Intronic
1183856126 22:40636378-40636400 CCCTGCTGCGCGCGTCCTCGGGG - Intronic
1183956345 22:41382469-41382491 CGCTCCAGGGCCCCTCCCCCGGG + Intronic
1184103194 22:42352406-42352428 CCCTCCAGGGCCAGTCCACTTGG + Intergenic
1185380892 22:50507170-50507192 CCCTCCAGAGCCCGTCCCCCAGG + Intronic
952476712 3:33718065-33718087 GCCTCCAGTGCGGGTCCCCGCGG + Intronic
952867176 3:37861950-37861972 CTCTCCCGGGCGCGGCTCCGGGG + Intronic
954468951 3:50675239-50675261 CCGTGCCGGGCGCGGCCCCGCGG - Exonic
961527765 3:127517879-127517901 ACCTCCAAGGCACGTCCCTGAGG - Intergenic
961664848 3:128488699-128488721 TCCTCCGGGGGGGGTCCCCGAGG + Intronic
961906047 3:130264151-130264173 CACTCCAGGGCGTGGCCCAGGGG - Intergenic
963870687 3:150410379-150410401 CCCTGCAGTGGGCGCCCCCGCGG + Exonic
967527686 3:190513920-190513942 CCGTCCAGGACGCCGCCCCGCGG + Intergenic
968187021 3:196639886-196639908 CCCGCGTGGGGGCGTCCCCGGGG + Intronic
968620307 4:1600955-1600977 CCCTCCAGGGCTGGGCCCTGGGG - Intergenic
969805252 4:9602692-9602714 GCCTACAGGGGACGTCCCCGAGG - Intergenic
972794020 4:42398449-42398471 CCCACCCGGCCGCGTCCCCCTGG - Intronic
978577153 4:110198875-110198897 GCTTGCAGGGCGCATCCCCGCGG + Intronic
981516922 4:145619494-145619516 TCCTCCAGGGGGCGCCCCGGAGG - Intronic
983779946 4:171656471-171656493 ACCTCCAGGGCTCGTCTCCCTGG + Intergenic
986681329 5:10235520-10235542 CCATCCAGGGCACGCCCCAGTGG + Intronic
995354600 5:111224022-111224044 CCCTCCAGCTCCGGTCCCCGCGG + Intronic
998154340 5:139776021-139776043 CCCTCCAAGACGCCTCCCCAAGG + Intergenic
1002445226 5:179286513-179286535 CTCTCCAGGGTGGGTCCCCTGGG - Intronic
1003617950 6:7672448-7672470 ACCTCCAGTGCGGGTCCCGGTGG + Intergenic
1005992808 6:30914110-30914132 CGGTCCCGGGCGCCTCCCCGTGG + Intronic
1013619238 6:111872755-111872777 CCCTGCGGGGTGCGGCCCCGAGG - Intronic
1017671930 6:156777587-156777609 CCCTCCTGTGCGCATCCACGCGG - Intergenic
1018960185 6:168441938-168441960 CGCTCCAGGCCGGGTCCCCGTGG - Intronic
1019105637 6:169664874-169664896 CCGTCCAGGGCGCCTCTCCGGGG + Intronic
1019105656 6:169664936-169664958 CCGTCCAGGGCGCCTCTCCGGGG + Intronic
1019105675 6:169664998-169665020 CCGTCCAGGGCGCCTCTCCGGGG + Intronic
1019105694 6:169665060-169665082 CCGTCCAGGGCGCCTCTCCGGGG + Intronic
1019105713 6:169665122-169665144 CCGTCCAGGGCGCCTCTCCGGGG + Intronic
1019461284 7:1160244-1160266 CCCGCCAGGCCGCGGCCCAGTGG + Intronic
1019732416 7:2635256-2635278 CCCTCAAGGGCCCCTGCCCGGGG - Intronic
1020118120 7:5487717-5487739 CCCTCCAGGGCGCCTGCCTGGGG - Intronic
1021313016 7:19116453-19116475 CTCACCAGGGCGCATCCCCCTGG + Intronic
1023263301 7:38379720-38379742 CCCTCCATGGTGCGTCACTGAGG - Intergenic
1026833644 7:73624284-73624306 CCCTCCTGGTCGCGCCGCCGGGG + Exonic
1030138652 7:106284401-106284423 CTCTCCACTGCGGGTCCCCGGGG + Intronic
1037962119 8:23105460-23105482 TCCTCCATGGCCCCTCCCCGTGG - Intronic
1049593025 8:143471239-143471261 CCCTCCAGGGCACGTCCGTCTGG + Intronic
1052872744 9:33524009-33524031 CGCTCCAGGGACCGTCCGCGGGG - Intergenic
1056741200 9:89256839-89256861 CCCTCCTGGGTGCCTCCCAGAGG - Intergenic
1057293036 9:93819209-93819231 GCCGCCAGGGCGCGGCCCCAAGG - Intergenic
1058866587 9:109166993-109167015 TCCCCCCGCGCGCGTCCCCGGGG + Exonic
1061864322 9:133484783-133484805 TCCTGCTGGGCGCCTCCCCGAGG + Intergenic
1062582962 9:137236473-137236495 CCCTGGAGGGGGGGTCCCCGCGG + Exonic
1186459214 X:9734842-9734864 CCCTCCAGGGAGCGAGCCAGGGG - Intronic
1188506422 X:30889218-30889240 CCCTGCACGGCGCGTACCCTGGG - Intronic
1190879697 X:54483541-54483563 CCCTCCTTGGCGCTTCCCCATGG - Intronic
1202378730 Y:24259219-24259241 CCCTCCACGGAGCATCCCCCCGG + Intergenic
1202492052 Y:25410902-25410924 CCCTCCACGGAGCATCCCCCCGG - Intergenic