ID: 931767868

View in Genome Browser
Species Human (GRCh38)
Location 2:65472846-65472868
Sequence GGGGTAAACTGACAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931767868_931767886 26 Left 931767868 2:65472846-65472868 CCCTGCCCCTGTCAGTTTACCCC No data
Right 931767886 2:65472895-65472917 CCTCAGTGAGCTCAGGTCCAGGG No data
931767868_931767875 -10 Left 931767868 2:65472846-65472868 CCCTGCCCCTGTCAGTTTACCCC No data
Right 931767875 2:65472859-65472881 AGTTTACCCCCAGGGTACTCTGG No data
931767868_931767884 25 Left 931767868 2:65472846-65472868 CCCTGCCCCTGTCAGTTTACCCC No data
Right 931767884 2:65472894-65472916 CCCTCAGTGAGCTCAGGTCCAGG No data
931767868_931767878 -3 Left 931767868 2:65472846-65472868 CCCTGCCCCTGTCAGTTTACCCC No data
Right 931767878 2:65472866-65472888 CCCCAGGGTACTCTGGCCACAGG No data
931767868_931767887 27 Left 931767868 2:65472846-65472868 CCCTGCCCCTGTCAGTTTACCCC No data
Right 931767887 2:65472896-65472918 CTCAGTGAGCTCAGGTCCAGGGG No data
931767868_931767882 19 Left 931767868 2:65472846-65472868 CCCTGCCCCTGTCAGTTTACCCC No data
Right 931767882 2:65472888-65472910 GACAGACCCTCAGTGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931767868 Original CRISPR GGGGTAAACTGACAGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr