ID: 931767874

View in Genome Browser
Species Human (GRCh38)
Location 2:65472853-65472875
Sequence TACCCTGGGGGTAAACTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931767874_931767886 19 Left 931767874 2:65472853-65472875 CCTGTCAGTTTACCCCCAGGGTA No data
Right 931767886 2:65472895-65472917 CCTCAGTGAGCTCAGGTCCAGGG No data
931767874_931767887 20 Left 931767874 2:65472853-65472875 CCTGTCAGTTTACCCCCAGGGTA No data
Right 931767887 2:65472896-65472918 CTCAGTGAGCTCAGGTCCAGGGG No data
931767874_931767882 12 Left 931767874 2:65472853-65472875 CCTGTCAGTTTACCCCCAGGGTA No data
Right 931767882 2:65472888-65472910 GACAGACCCTCAGTGAGCTCAGG No data
931767874_931767884 18 Left 931767874 2:65472853-65472875 CCTGTCAGTTTACCCCCAGGGTA No data
Right 931767884 2:65472894-65472916 CCCTCAGTGAGCTCAGGTCCAGG No data
931767874_931767878 -10 Left 931767874 2:65472853-65472875 CCTGTCAGTTTACCCCCAGGGTA No data
Right 931767878 2:65472866-65472888 CCCCAGGGTACTCTGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931767874 Original CRISPR TACCCTGGGGGTAAACTGAC AGG (reversed) Intergenic
No off target data available for this crispr