ID: 931767876

View in Genome Browser
Species Human (GRCh38)
Location 2:65472865-65472887
Sequence CTGTGGCCAGAGTACCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931767876_931767884 6 Left 931767876 2:65472865-65472887 CCCCCAGGGTACTCTGGCCACAG No data
Right 931767884 2:65472894-65472916 CCCTCAGTGAGCTCAGGTCCAGG No data
931767876_931767882 0 Left 931767876 2:65472865-65472887 CCCCCAGGGTACTCTGGCCACAG No data
Right 931767882 2:65472888-65472910 GACAGACCCTCAGTGAGCTCAGG No data
931767876_931767886 7 Left 931767876 2:65472865-65472887 CCCCCAGGGTACTCTGGCCACAG No data
Right 931767886 2:65472895-65472917 CCTCAGTGAGCTCAGGTCCAGGG No data
931767876_931767887 8 Left 931767876 2:65472865-65472887 CCCCCAGGGTACTCTGGCCACAG No data
Right 931767887 2:65472896-65472918 CTCAGTGAGCTCAGGTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931767876 Original CRISPR CTGTGGCCAGAGTACCCTGG GGG (reversed) Intergenic
No off target data available for this crispr