ID: 931767878

View in Genome Browser
Species Human (GRCh38)
Location 2:65472866-65472888
Sequence CCCCAGGGTACTCTGGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931767866_931767878 14 Left 931767866 2:65472829-65472851 CCAAGGTGCCTGGAGCACCCTGC No data
Right 931767878 2:65472866-65472888 CCCCAGGGTACTCTGGCCACAGG No data
931767867_931767878 6 Left 931767867 2:65472837-65472859 CCTGGAGCACCCTGCCCCTGTCA No data
Right 931767878 2:65472866-65472888 CCCCAGGGTACTCTGGCCACAGG No data
931767868_931767878 -3 Left 931767868 2:65472846-65472868 CCCTGCCCCTGTCAGTTTACCCC No data
Right 931767878 2:65472866-65472888 CCCCAGGGTACTCTGGCCACAGG No data
931767865_931767878 15 Left 931767865 2:65472828-65472850 CCCAAGGTGCCTGGAGCACCCTG No data
Right 931767878 2:65472866-65472888 CCCCAGGGTACTCTGGCCACAGG No data
931767873_931767878 -9 Left 931767873 2:65472852-65472874 CCCTGTCAGTTTACCCCCAGGGT No data
Right 931767878 2:65472866-65472888 CCCCAGGGTACTCTGGCCACAGG No data
931767871_931767878 -8 Left 931767871 2:65472851-65472873 CCCCTGTCAGTTTACCCCCAGGG No data
Right 931767878 2:65472866-65472888 CCCCAGGGTACTCTGGCCACAGG No data
931767874_931767878 -10 Left 931767874 2:65472853-65472875 CCTGTCAGTTTACCCCCAGGGTA No data
Right 931767878 2:65472866-65472888 CCCCAGGGTACTCTGGCCACAGG No data
931767869_931767878 -4 Left 931767869 2:65472847-65472869 CCTGCCCCTGTCAGTTTACCCCC No data
Right 931767878 2:65472866-65472888 CCCCAGGGTACTCTGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931767878 Original CRISPR CCCCAGGGTACTCTGGCCAC AGG Intergenic
No off target data available for this crispr