ID: 931767880

View in Genome Browser
Species Human (GRCh38)
Location 2:65472868-65472890
Sequence GTCCTGTGGCCAGAGTACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931767880_931767886 4 Left 931767880 2:65472868-65472890 CCAGGGTACTCTGGCCACAGGAC No data
Right 931767886 2:65472895-65472917 CCTCAGTGAGCTCAGGTCCAGGG No data
931767880_931767882 -3 Left 931767880 2:65472868-65472890 CCAGGGTACTCTGGCCACAGGAC No data
Right 931767882 2:65472888-65472910 GACAGACCCTCAGTGAGCTCAGG No data
931767880_931767884 3 Left 931767880 2:65472868-65472890 CCAGGGTACTCTGGCCACAGGAC No data
Right 931767884 2:65472894-65472916 CCCTCAGTGAGCTCAGGTCCAGG No data
931767880_931767887 5 Left 931767880 2:65472868-65472890 CCAGGGTACTCTGGCCACAGGAC No data
Right 931767887 2:65472896-65472918 CTCAGTGAGCTCAGGTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931767880 Original CRISPR GTCCTGTGGCCAGAGTACCC TGG (reversed) Intergenic
No off target data available for this crispr