ID: 931767881

View in Genome Browser
Species Human (GRCh38)
Location 2:65472882-65472904
Sequence CTCACTGAGGGTCTGTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931767881_931767886 -10 Left 931767881 2:65472882-65472904 CCACAGGACAGACCCTCAGTGAG No data
Right 931767886 2:65472895-65472917 CCTCAGTGAGCTCAGGTCCAGGG No data
931767881_931767887 -9 Left 931767881 2:65472882-65472904 CCACAGGACAGACCCTCAGTGAG No data
Right 931767887 2:65472896-65472918 CTCAGTGAGCTCAGGTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931767881 Original CRISPR CTCACTGAGGGTCTGTCCTG TGG (reversed) Intergenic
No off target data available for this crispr