ID: 931767884

View in Genome Browser
Species Human (GRCh38)
Location 2:65472894-65472916
Sequence CCCTCAGTGAGCTCAGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931767874_931767884 18 Left 931767874 2:65472853-65472875 CCTGTCAGTTTACCCCCAGGGTA No data
Right 931767884 2:65472894-65472916 CCCTCAGTGAGCTCAGGTCCAGG No data
931767868_931767884 25 Left 931767868 2:65472846-65472868 CCCTGCCCCTGTCAGTTTACCCC No data
Right 931767884 2:65472894-65472916 CCCTCAGTGAGCTCAGGTCCAGG No data
931767880_931767884 3 Left 931767880 2:65472868-65472890 CCAGGGTACTCTGGCCACAGGAC No data
Right 931767884 2:65472894-65472916 CCCTCAGTGAGCTCAGGTCCAGG No data
931767869_931767884 24 Left 931767869 2:65472847-65472869 CCTGCCCCTGTCAGTTTACCCCC No data
Right 931767884 2:65472894-65472916 CCCTCAGTGAGCTCAGGTCCAGG No data
931767876_931767884 6 Left 931767876 2:65472865-65472887 CCCCCAGGGTACTCTGGCCACAG No data
Right 931767884 2:65472894-65472916 CCCTCAGTGAGCTCAGGTCCAGG No data
931767871_931767884 20 Left 931767871 2:65472851-65472873 CCCCTGTCAGTTTACCCCCAGGG No data
Right 931767884 2:65472894-65472916 CCCTCAGTGAGCTCAGGTCCAGG No data
931767877_931767884 5 Left 931767877 2:65472866-65472888 CCCCAGGGTACTCTGGCCACAGG No data
Right 931767884 2:65472894-65472916 CCCTCAGTGAGCTCAGGTCCAGG No data
931767873_931767884 19 Left 931767873 2:65472852-65472874 CCCTGTCAGTTTACCCCCAGGGT No data
Right 931767884 2:65472894-65472916 CCCTCAGTGAGCTCAGGTCCAGG No data
931767879_931767884 4 Left 931767879 2:65472867-65472889 CCCAGGGTACTCTGGCCACAGGA No data
Right 931767884 2:65472894-65472916 CCCTCAGTGAGCTCAGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931767884 Original CRISPR CCCTCAGTGAGCTCAGGTCC AGG Intergenic
No off target data available for this crispr