ID: 931772689

View in Genome Browser
Species Human (GRCh38)
Location 2:65512125-65512147
Sequence AATGGTGCACATGAATGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931772689_931772695 12 Left 931772689 2:65512125-65512147 CCAGGACATTCATGTGCACCATT No data
Right 931772695 2:65512160-65512182 AAAGATAAAGGCAAGAGGACAGG No data
931772689_931772694 7 Left 931772689 2:65512125-65512147 CCAGGACATTCATGTGCACCATT No data
Right 931772694 2:65512155-65512177 TGCAGAAAGATAAAGGCAAGAGG No data
931772689_931772693 0 Left 931772689 2:65512125-65512147 CCAGGACATTCATGTGCACCATT No data
Right 931772693 2:65512148-65512170 GTGGCGGTGCAGAAAGATAAAGG No data
931772689_931772697 16 Left 931772689 2:65512125-65512147 CCAGGACATTCATGTGCACCATT No data
Right 931772697 2:65512164-65512186 ATAAAGGCAAGAGGACAGGAGGG No data
931772689_931772698 17 Left 931772689 2:65512125-65512147 CCAGGACATTCATGTGCACCATT No data
Right 931772698 2:65512165-65512187 TAAAGGCAAGAGGACAGGAGGGG No data
931772689_931772696 15 Left 931772689 2:65512125-65512147 CCAGGACATTCATGTGCACCATT No data
Right 931772696 2:65512163-65512185 GATAAAGGCAAGAGGACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931772689 Original CRISPR AATGGTGCACATGAATGTCC TGG (reversed) Intergenic
No off target data available for this crispr