ID: 931772693

View in Genome Browser
Species Human (GRCh38)
Location 2:65512148-65512170
Sequence GTGGCGGTGCAGAAAGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931772689_931772693 0 Left 931772689 2:65512125-65512147 CCAGGACATTCATGTGCACCATT No data
Right 931772693 2:65512148-65512170 GTGGCGGTGCAGAAAGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931772693 Original CRISPR GTGGCGGTGCAGAAAGATAA AGG Intergenic
No off target data available for this crispr