ID: 931773403

View in Genome Browser
Species Human (GRCh38)
Location 2:65518680-65518702
Sequence GTTTTAAGCAGAAAGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931773403_931773407 0 Left 931773403 2:65518680-65518702 CCTCCTTTCTTTCTGCTTAAAAC No data
Right 931773407 2:65518703-65518725 CCCTCTGTTCTTAATGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931773403 Original CRISPR GTTTTAAGCAGAAAGAAAGG AGG (reversed) Intergenic
No off target data available for this crispr