ID: 931781129

View in Genome Browser
Species Human (GRCh38)
Location 2:65580134-65580156
Sequence ATGGAGGGGGAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931781129_931781142 12 Left 931781129 2:65580134-65580156 CCATCCTCCTTCTCCCCCTCCAT No data
Right 931781142 2:65580169-65580191 GCCTCCTTTTCTTTCTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931781129 Original CRISPR ATGGAGGGGGAGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr