ID: 931782132

View in Genome Browser
Species Human (GRCh38)
Location 2:65587883-65587905
Sequence CACACACATATGCAGATCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931782132_931782133 15 Left 931782132 2:65587883-65587905 CCAGCGATCTGCATATGTGTGTG No data
Right 931782133 2:65587921-65587943 GTGTGAGTGCATGTGTCTTTTGG No data
931782132_931782134 16 Left 931782132 2:65587883-65587905 CCAGCGATCTGCATATGTGTGTG No data
Right 931782134 2:65587922-65587944 TGTGAGTGCATGTGTCTTTTGGG 0: 53
1: 254
2: 564
3: 1281
4: 2678
931782132_931782135 27 Left 931782132 2:65587883-65587905 CCAGCGATCTGCATATGTGTGTG No data
Right 931782135 2:65587933-65587955 GTGTCTTTTGGGTGAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931782132 Original CRISPR CACACACATATGCAGATCGC TGG (reversed) Intergenic
No off target data available for this crispr