ID: 931783265

View in Genome Browser
Species Human (GRCh38)
Location 2:65598412-65598434
Sequence GATGACTTACGAGAACAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931783263_931783265 -4 Left 931783263 2:65598393-65598415 CCTCCAAGTGTTCAATTAGGATG No data
Right 931783265 2:65598412-65598434 GATGACTTACGAGAACAGAGTGG No data
931783260_931783265 20 Left 931783260 2:65598369-65598391 CCTATGTGGACAGGGCCTGAGTT No data
Right 931783265 2:65598412-65598434 GATGACTTACGAGAACAGAGTGG No data
931783261_931783265 5 Left 931783261 2:65598384-65598406 CCTGAGTTTCCTCCAAGTGTTCA No data
Right 931783265 2:65598412-65598434 GATGACTTACGAGAACAGAGTGG No data
931783264_931783265 -7 Left 931783264 2:65598396-65598418 CCAAGTGTTCAATTAGGATGACT No data
Right 931783265 2:65598412-65598434 GATGACTTACGAGAACAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931783265 Original CRISPR GATGACTTACGAGAACAGAG TGG Intergenic
No off target data available for this crispr