ID: 931789376

View in Genome Browser
Species Human (GRCh38)
Location 2:65650334-65650356
Sequence GCCTAGTGATCCCGCCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931789376_931789377 3 Left 931789376 2:65650334-65650356 CCAGAGAGGCGGGATCACTAGGC No data
Right 931789377 2:65650360-65650382 GTGCAAAAACACAGTAACCATGG No data
931789376_931789378 6 Left 931789376 2:65650334-65650356 CCAGAGAGGCGGGATCACTAGGC No data
Right 931789378 2:65650363-65650385 CAAAAACACAGTAACCATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931789376 Original CRISPR GCCTAGTGATCCCGCCTCTC TGG (reversed) Intergenic
No off target data available for this crispr