ID: 931790054

View in Genome Browser
Species Human (GRCh38)
Location 2:65656992-65657014
Sequence TACAAAACTTAGCTGGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931790049_931790054 -5 Left 931790049 2:65656974-65656996 CCCCATCTCTACTAAAAATACAA 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
Right 931790054 2:65656992-65657014 TACAAAACTTAGCTGGGCTGTGG No data
931790047_931790054 14 Left 931790047 2:65656955-65656977 CCTGACCAATGTGATGAAACCCC 0: 34
1: 697
2: 5926
3: 37783
4: 135947
Right 931790054 2:65656992-65657014 TACAAAACTTAGCTGGGCTGTGG No data
931790051_931790054 -7 Left 931790051 2:65656976-65656998 CCATCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 931790054 2:65656992-65657014 TACAAAACTTAGCTGGGCTGTGG No data
931790046_931790054 18 Left 931790046 2:65656951-65656973 CCAGCCTGACCAATGTGATGAAA 0: 48
1: 1035
2: 8774
3: 51154
4: 165091
Right 931790054 2:65656992-65657014 TACAAAACTTAGCTGGGCTGTGG No data
931790048_931790054 9 Left 931790048 2:65656960-65656982 CCAATGTGATGAAACCCCATCTC 0: 65
1: 1412
2: 11882
3: 64969
4: 114644
Right 931790054 2:65656992-65657014 TACAAAACTTAGCTGGGCTGTGG No data
931790050_931790054 -6 Left 931790050 2:65656975-65656997 CCCATCTCTACTAAAAATACAAA 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
Right 931790054 2:65656992-65657014 TACAAAACTTAGCTGGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931790054 Original CRISPR TACAAAACTTAGCTGGGCTG TGG Intergenic
No off target data available for this crispr