ID: 931791642

View in Genome Browser
Species Human (GRCh38)
Location 2:65668970-65668992
Sequence CTTCCTGCTAATGCAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931791642_931791649 28 Left 931791642 2:65668970-65668992 CCAGAAGCTGCATTAGCAGGAAG No data
Right 931791649 2:65669021-65669043 TCCAAGGCCCTTTTCAGATGTGG No data
931791642_931791645 -10 Left 931791642 2:65668970-65668992 CCAGAAGCTGCATTAGCAGGAAG No data
Right 931791645 2:65668983-65669005 TAGCAGGAAGAGTGTGGGAAAGG No data
931791642_931791646 12 Left 931791642 2:65668970-65668992 CCAGAAGCTGCATTAGCAGGAAG No data
Right 931791646 2:65669005-65669027 GAGATTGTGTGTGCCCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931791642 Original CRISPR CTTCCTGCTAATGCAGCTTC TGG (reversed) Intergenic
No off target data available for this crispr