ID: 931791649

View in Genome Browser
Species Human (GRCh38)
Location 2:65669021-65669043
Sequence TCCAAGGCCCTTTTCAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931791642_931791649 28 Left 931791642 2:65668970-65668992 CCAGAAGCTGCATTAGCAGGAAG No data
Right 931791649 2:65669021-65669043 TCCAAGGCCCTTTTCAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931791649 Original CRISPR TCCAAGGCCCTTTTCAGATG TGG Intergenic
No off target data available for this crispr