ID: 931793569

View in Genome Browser
Species Human (GRCh38)
Location 2:65688264-65688286
Sequence GGTGTGAAACAGCCTCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931793566_931793569 2 Left 931793566 2:65688239-65688261 CCACTAGGGAAGCTTCAGAGTCA No data
Right 931793569 2:65688264-65688286 GGTGTGAAACAGCCTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931793569 Original CRISPR GGTGTGAAACAGCCTCAAGC AGG Intergenic
No off target data available for this crispr