ID: 931795110

View in Genome Browser
Species Human (GRCh38)
Location 2:65701016-65701038
Sequence TGTGCCTCGTTGGGTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931795107_931795110 -8 Left 931795107 2:65701001-65701023 CCAGGGTACTTCTAGTGTGCCTC No data
Right 931795110 2:65701016-65701038 TGTGCCTCGTTGGGTAAAACAGG No data
931795106_931795110 -2 Left 931795106 2:65700995-65701017 CCAGGTCCAGGGTACTTCTAGTG No data
Right 931795110 2:65701016-65701038 TGTGCCTCGTTGGGTAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931795110 Original CRISPR TGTGCCTCGTTGGGTAAAAC AGG Intergenic
No off target data available for this crispr