ID: 931798415

View in Genome Browser
Species Human (GRCh38)
Location 2:65734362-65734384
Sequence TTTTTTTTGCAGGACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931798415_931798420 18 Left 931798415 2:65734362-65734384 CCATCCATGTCCTGCAAAAAAAA No data
Right 931798420 2:65734403-65734425 AATGGCTGCCTGGTATTCTGTGG No data
931798415_931798419 8 Left 931798415 2:65734362-65734384 CCATCCATGTCCTGCAAAAAAAA No data
Right 931798419 2:65734393-65734415 CATTCTTTTTAATGGCTGCCTGG No data
931798415_931798418 0 Left 931798415 2:65734362-65734384 CCATCCATGTCCTGCAAAAAAAA No data
Right 931798418 2:65734385-65734407 CATGATCTCATTCTTTTTAATGG 0: 26
1: 1153
2: 5331
3: 13642
4: 23144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931798415 Original CRISPR TTTTTTTTGCAGGACATGGA TGG (reversed) Intergenic
No off target data available for this crispr