ID: 931799626

View in Genome Browser
Species Human (GRCh38)
Location 2:65746308-65746330
Sequence ATTGATAAAGGCCTTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931799621_931799626 21 Left 931799621 2:65746264-65746286 CCAGCACGATCAGGTTGTATCAC No data
Right 931799626 2:65746308-65746330 ATTGATAAAGGCCTTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931799626 Original CRISPR ATTGATAAAGGCCTTTTTGT TGG Intergenic
No off target data available for this crispr