ID: 931801226

View in Genome Browser
Species Human (GRCh38)
Location 2:65760124-65760146
Sequence TAGGATGACATTAATGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931801221_931801226 13 Left 931801221 2:65760088-65760110 CCAGTAATTTAGGCAAGAAGTGA No data
Right 931801226 2:65760124-65760146 TAGGATGACATTAATGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931801226 Original CRISPR TAGGATGACATTAATGAAGT TGG Intergenic
No off target data available for this crispr