ID: 931812111

View in Genome Browser
Species Human (GRCh38)
Location 2:65864091-65864113
Sequence AGCAGTGTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931812103_931812111 22 Left 931812103 2:65864046-65864068 CCTGGAGAGTGCATCAAGAATTT No data
Right 931812111 2:65864091-65864113 AGCAGTGTGCAGAAGATGGCAGG No data
931812102_931812111 26 Left 931812102 2:65864042-65864064 CCAGCCTGGAGAGTGCATCAAGA No data
Right 931812111 2:65864091-65864113 AGCAGTGTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931812111 Original CRISPR AGCAGTGTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr