ID: 931815516

View in Genome Browser
Species Human (GRCh38)
Location 2:65896890-65896912
Sequence CTGAGGATACAGCAGAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931815516_931815518 7 Left 931815516 2:65896890-65896912 CCTTTTCTCTGCTGTATCCTCAG No data
Right 931815518 2:65896920-65896942 AGCAGAACCTGATGCACAGCAGG No data
931815516_931815520 27 Left 931815516 2:65896890-65896912 CCTTTTCTCTGCTGTATCCTCAG No data
Right 931815520 2:65896940-65896962 AGGTGCTCAAAAATGTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931815516 Original CRISPR CTGAGGATACAGCAGAGAAA AGG (reversed) Intergenic