ID: 931815517

View in Genome Browser
Species Human (GRCh38)
Location 2:65896907-65896929
Sequence AGGTTCTGCTGTAAATGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931815517_931815520 10 Left 931815517 2:65896907-65896929 CCTCAGCATTTACAGCAGAACCT No data
Right 931815520 2:65896940-65896962 AGGTGCTCAAAAATGTTAACTGG No data
931815517_931815518 -10 Left 931815517 2:65896907-65896929 CCTCAGCATTTACAGCAGAACCT No data
Right 931815518 2:65896920-65896942 AGCAGAACCTGATGCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931815517 Original CRISPR AGGTTCTGCTGTAAATGCTG AGG (reversed) Intergenic