ID: 931815518

View in Genome Browser
Species Human (GRCh38)
Location 2:65896920-65896942
Sequence AGCAGAACCTGATGCACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931815515_931815518 16 Left 931815515 2:65896881-65896903 CCTCACTTTCCTTTTCTCTGCTG No data
Right 931815518 2:65896920-65896942 AGCAGAACCTGATGCACAGCAGG No data
931815517_931815518 -10 Left 931815517 2:65896907-65896929 CCTCAGCATTTACAGCAGAACCT No data
Right 931815518 2:65896920-65896942 AGCAGAACCTGATGCACAGCAGG No data
931815516_931815518 7 Left 931815516 2:65896890-65896912 CCTTTTCTCTGCTGTATCCTCAG No data
Right 931815518 2:65896920-65896942 AGCAGAACCTGATGCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931815518 Original CRISPR AGCAGAACCTGATGCACAGC AGG Intergenic