ID: 931815519

View in Genome Browser
Species Human (GRCh38)
Location 2:65896927-65896949
Sequence TTGAGCACCTGCTGTGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931815519_931815520 -10 Left 931815519 2:65896927-65896949 CCTGATGCACAGCAGGTGCTCAA No data
Right 931815520 2:65896940-65896962 AGGTGCTCAAAAATGTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931815519 Original CRISPR TTGAGCACCTGCTGTGCATC AGG (reversed) Intergenic