ID: 931815520

View in Genome Browser
Species Human (GRCh38)
Location 2:65896940-65896962
Sequence AGGTGCTCAAAAATGTTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931815516_931815520 27 Left 931815516 2:65896890-65896912 CCTTTTCTCTGCTGTATCCTCAG No data
Right 931815520 2:65896940-65896962 AGGTGCTCAAAAATGTTAACTGG No data
931815519_931815520 -10 Left 931815519 2:65896927-65896949 CCTGATGCACAGCAGGTGCTCAA No data
Right 931815520 2:65896940-65896962 AGGTGCTCAAAAATGTTAACTGG No data
931815517_931815520 10 Left 931815517 2:65896907-65896929 CCTCAGCATTTACAGCAGAACCT No data
Right 931815520 2:65896940-65896962 AGGTGCTCAAAAATGTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931815520 Original CRISPR AGGTGCTCAAAAATGTTAAC TGG Intergenic
No off target data available for this crispr