ID: 931816954

View in Genome Browser
Species Human (GRCh38)
Location 2:65914037-65914059
Sequence TGCAGTAGCAACGGCATCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931816950_931816954 6 Left 931816950 2:65914008-65914030 CCTTAGTCTTAATTGTTCTCTTA No data
Right 931816954 2:65914037-65914059 TGCAGTAGCAACGGCATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931816954 Original CRISPR TGCAGTAGCAACGGCATCTG GGG Intergenic
No off target data available for this crispr