ID: 931817726

View in Genome Browser
Species Human (GRCh38)
Location 2:65921223-65921245
Sequence GGTCCAAGGGGGAGTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931817726_931817735 14 Left 931817726 2:65921223-65921245 CCCATAGCACTCCCCCTTGGACC No data
Right 931817735 2:65921260-65921282 ACCCTCTGCTCTGGCATCTCAGG No data
931817726_931817737 15 Left 931817726 2:65921223-65921245 CCCATAGCACTCCCCCTTGGACC No data
Right 931817737 2:65921261-65921283 CCCTCTGCTCTGGCATCTCAGGG No data
931817726_931817734 5 Left 931817726 2:65921223-65921245 CCCATAGCACTCCCCCTTGGACC No data
Right 931817734 2:65921251-65921273 TGGCACTTTACCCTCTGCTCTGG No data
931817726_931817739 21 Left 931817726 2:65921223-65921245 CCCATAGCACTCCCCCTTGGACC No data
Right 931817739 2:65921267-65921289 GCTCTGGCATCTCAGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931817726 Original CRISPR GGTCCAAGGGGGAGTGCTAT GGG (reversed) Intergenic
No off target data available for this crispr