ID: 931818000

View in Genome Browser
Species Human (GRCh38)
Location 2:65923445-65923467
Sequence CATTTCAGGAAGACCGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931817996_931818000 2 Left 931817996 2:65923420-65923442 CCAAAATTAGGACTGGCTGTTTG No data
Right 931818000 2:65923445-65923467 CATTTCAGGAAGACCGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931818000 Original CRISPR CATTTCAGGAAGACCGTGGA TGG Intergenic
No off target data available for this crispr