ID: 931818000 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:65923445-65923467 |
| Sequence | CATTTCAGGAAGACCGTGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 931817996_931818000 | 2 | Left | 931817996 | 2:65923420-65923442 | CCAAAATTAGGACTGGCTGTTTG | No data | ||
| Right | 931818000 | 2:65923445-65923467 | CATTTCAGGAAGACCGTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 931818000 | Original CRISPR | CATTTCAGGAAGACCGTGGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||