ID: 931833545

View in Genome Browser
Species Human (GRCh38)
Location 2:66076169-66076191
Sequence AAATACCAACATATGTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931833542_931833545 -9 Left 931833542 2:66076155-66076177 CCCACCAGGACTTCAAATACCAA No data
Right 931833545 2:66076169-66076191 AAATACCAACATATGTATCAAGG No data
931833541_931833545 -2 Left 931833541 2:66076148-66076170 CCTCATTCCCACCAGGACTTCAA No data
Right 931833545 2:66076169-66076191 AAATACCAACATATGTATCAAGG No data
931833543_931833545 -10 Left 931833543 2:66076156-66076178 CCACCAGGACTTCAAATACCAAC No data
Right 931833545 2:66076169-66076191 AAATACCAACATATGTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931833545 Original CRISPR AAATACCAACATATGTATCA AGG Intergenic
No off target data available for this crispr