ID: 931833545 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:66076169-66076191 |
| Sequence | AAATACCAACATATGTATCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 931833542_931833545 | -9 | Left | 931833542 | 2:66076155-66076177 | CCCACCAGGACTTCAAATACCAA | No data | ||
| Right | 931833545 | 2:66076169-66076191 | AAATACCAACATATGTATCAAGG | No data | ||||
| 931833541_931833545 | -2 | Left | 931833541 | 2:66076148-66076170 | CCTCATTCCCACCAGGACTTCAA | No data | ||
| Right | 931833545 | 2:66076169-66076191 | AAATACCAACATATGTATCAAGG | No data | ||||
| 931833543_931833545 | -10 | Left | 931833543 | 2:66076156-66076178 | CCACCAGGACTTCAAATACCAAC | No data | ||
| Right | 931833545 | 2:66076169-66076191 | AAATACCAACATATGTATCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 931833545 | Original CRISPR | AAATACCAACATATGTATCA AGG | Intergenic | ||
| No off target data available for this crispr | |||||