ID: 931836907

View in Genome Browser
Species Human (GRCh38)
Location 2:66108738-66108760
Sequence CCGTGGAAGGGTCAGTGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931836901_931836907 -7 Left 931836901 2:66108722-66108744 CCACCTTATAAATGACCCGTGGA No data
Right 931836907 2:66108738-66108760 CCGTGGAAGGGTCAGTGATATGG No data
931836902_931836907 -10 Left 931836902 2:66108725-66108747 CCTTATAAATGACCCGTGGAAGG No data
Right 931836907 2:66108738-66108760 CCGTGGAAGGGTCAGTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931836907 Original CRISPR CCGTGGAAGGGTCAGTGATA TGG Intergenic
No off target data available for this crispr