ID: 931838081

View in Genome Browser
Species Human (GRCh38)
Location 2:66120742-66120764
Sequence ACTCCTGTTGCTCCACATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931838079_931838081 9 Left 931838079 2:66120710-66120732 CCATTTTTCATTTCTACCAGCAA No data
Right 931838081 2:66120742-66120764 ACTCCTGTTGCTCCACATTCTGG No data
931838078_931838081 23 Left 931838078 2:66120696-66120718 CCAAAGTGGCTGTACCATTTTTC 0: 15
1: 331
2: 1258
3: 2800
4: 5336
Right 931838081 2:66120742-66120764 ACTCCTGTTGCTCCACATTCTGG No data
931838080_931838081 -7 Left 931838080 2:66120726-66120748 CCAGCAATGAATGAGAACTCCTG No data
Right 931838081 2:66120742-66120764 ACTCCTGTTGCTCCACATTCTGG No data
931838077_931838081 24 Left 931838077 2:66120695-66120717 CCCAAAGTGGCTGTACCATTTTT No data
Right 931838081 2:66120742-66120764 ACTCCTGTTGCTCCACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931838081 Original CRISPR ACTCCTGTTGCTCCACATTC TGG Intergenic
No off target data available for this crispr