ID: 931840832

View in Genome Browser
Species Human (GRCh38)
Location 2:66146486-66146508
Sequence CTAGTTTCCCTGTACTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931840832_931840834 6 Left 931840832 2:66146486-66146508 CCAGCAGAGTACAGGGAAACTAG No data
Right 931840834 2:66146515-66146537 TAGTGCAGTACTTTCAGTCTAGG No data
931840832_931840836 16 Left 931840832 2:66146486-66146508 CCAGCAGAGTACAGGGAAACTAG No data
Right 931840836 2:66146525-66146547 CTTTCAGTCTAGGAGCAGTAGGG No data
931840832_931840835 15 Left 931840832 2:66146486-66146508 CCAGCAGAGTACAGGGAAACTAG No data
Right 931840835 2:66146524-66146546 ACTTTCAGTCTAGGAGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931840832 Original CRISPR CTAGTTTCCCTGTACTCTGC TGG (reversed) Intergenic
No off target data available for this crispr