ID: 931842735

View in Genome Browser
Species Human (GRCh38)
Location 2:66171378-66171400
Sequence TTTTATTCAAATAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931842731_931842735 27 Left 931842731 2:66171328-66171350 CCTGCTTAATGCAGTTTTCTGAT No data
Right 931842735 2:66171378-66171400 TTTTATTCAAATAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931842735 Original CRISPR TTTTATTCAAATAAGGAGGA AGG Intergenic
No off target data available for this crispr