ID: 931845015

View in Genome Browser
Species Human (GRCh38)
Location 2:66194283-66194305
Sequence CAAGGGTTGTCCAGTGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931845010_931845015 1 Left 931845010 2:66194259-66194281 CCTACTCTCTCTCAAGCTGTAAT No data
Right 931845015 2:66194283-66194305 CAAGGGTTGTCCAGTGCCACGGG No data
931845009_931845015 4 Left 931845009 2:66194256-66194278 CCTCCTACTCTCTCTCAAGCTGT No data
Right 931845015 2:66194283-66194305 CAAGGGTTGTCCAGTGCCACGGG No data
931845008_931845015 21 Left 931845008 2:66194239-66194261 CCGCAGCTGTGGTCTGGCCTCCT No data
Right 931845015 2:66194283-66194305 CAAGGGTTGTCCAGTGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931845015 Original CRISPR CAAGGGTTGTCCAGTGCCAC GGG Intergenic