ID: 931845985

View in Genome Browser
Species Human (GRCh38)
Location 2:66204289-66204311
Sequence CTCACAAATGGGAAGTTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931845985_931845992 19 Left 931845985 2:66204289-66204311 CCTATCAACTTCCCATTTGTGAG No data
Right 931845992 2:66204331-66204353 GTTAGCAATTTTCATTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931845985 Original CRISPR CTCACAAATGGGAAGTTGAT AGG (reversed) Intergenic
No off target data available for this crispr