ID: 931847300

View in Genome Browser
Species Human (GRCh38)
Location 2:66217803-66217825
Sequence CAGTAAGTTTTTAACGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931847300_931847301 -4 Left 931847300 2:66217803-66217825 CCTTGTTCGTTAAAAACTTACTG No data
Right 931847301 2:66217822-66217844 ACTGACTTATAATCAACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931847300 Original CRISPR CAGTAAGTTTTTAACGAACA AGG (reversed) Intergenic
No off target data available for this crispr