ID: 931848249

View in Genome Browser
Species Human (GRCh38)
Location 2:66226811-66226833
Sequence TTGGTAGCAAGAAGACTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931848243_931848249 19 Left 931848243 2:66226769-66226791 CCAACCACAATTTAGGAAATGGT No data
Right 931848249 2:66226811-66226833 TTGGTAGCAAGAAGACTTGATGG No data
931848239_931848249 30 Left 931848239 2:66226758-66226780 CCCTGGGAACACCAACCACAATT No data
Right 931848249 2:66226811-66226833 TTGGTAGCAAGAAGACTTGATGG No data
931848240_931848249 29 Left 931848240 2:66226759-66226781 CCTGGGAACACCAACCACAATTT No data
Right 931848249 2:66226811-66226833 TTGGTAGCAAGAAGACTTGATGG No data
931848246_931848249 -4 Left 931848246 2:66226792-66226814 CCCATGCTAAAGGCTGTTTTTGG No data
Right 931848249 2:66226811-66226833 TTGGTAGCAAGAAGACTTGATGG No data
931848244_931848249 15 Left 931848244 2:66226773-66226795 CCACAATTTAGGAAATGGTCCCA No data
Right 931848249 2:66226811-66226833 TTGGTAGCAAGAAGACTTGATGG No data
931848248_931848249 -5 Left 931848248 2:66226793-66226815 CCATGCTAAAGGCTGTTTTTGGT No data
Right 931848249 2:66226811-66226833 TTGGTAGCAAGAAGACTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931848249 Original CRISPR TTGGTAGCAAGAAGACTTGA TGG Intergenic
No off target data available for this crispr