ID: 931851362

View in Genome Browser
Species Human (GRCh38)
Location 2:66254327-66254349
Sequence TAGCAGAGGCTGCCCTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931851360_931851362 0 Left 931851360 2:66254304-66254326 CCTTAAGATAGATGCATAGCTTC No data
Right 931851362 2:66254327-66254349 TAGCAGAGGCTGCCCTTGACTGG No data
931851359_931851362 15 Left 931851359 2:66254289-66254311 CCAAATTGTCAAGTTCCTTAAGA No data
Right 931851362 2:66254327-66254349 TAGCAGAGGCTGCCCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931851362 Original CRISPR TAGCAGAGGCTGCCCTTGAC TGG Intergenic
No off target data available for this crispr