ID: 931853942

View in Genome Browser
Species Human (GRCh38)
Location 2:66281978-66282000
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931853942_931853950 27 Left 931853942 2:66281978-66282000 CCCTAGTTCAGGTTCTGATCAGT No data
Right 931853950 2:66282028-66282050 TTTACTGTCCTTCCTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931853942 Original CRISPR ACTGATCAGAACCTGAACTA GGG (reversed) Intergenic