ID: 931853943

View in Genome Browser
Species Human (GRCh38)
Location 2:66281979-66282001
Sequence AACTGATCAGAACCTGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931853943_931853950 26 Left 931853943 2:66281979-66282001 CCTAGTTCAGGTTCTGATCAGTT No data
Right 931853950 2:66282028-66282050 TTTACTGTCCTTCCTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931853943 Original CRISPR AACTGATCAGAACCTGAACT AGG (reversed) Intergenic