ID: 931853944

View in Genome Browser
Species Human (GRCh38)
Location 2:66282006-66282028
Sequence AGGGGCTTTGGGCATAATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931853944_931853950 -1 Left 931853944 2:66282006-66282028 CCTAGATTATGCCCAAAGCCCCT No data
Right 931853950 2:66282028-66282050 TTTACTGTCCTTCCTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931853944 Original CRISPR AGGGGCTTTGGGCATAATCT AGG (reversed) Intergenic