ID: 931859285

View in Genome Browser
Species Human (GRCh38)
Location 2:66337044-66337066
Sequence CTATGCTCCTTTAAATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931859284_931859285 6 Left 931859284 2:66337015-66337037 CCAAGAGTATAAAATAAATTTGA No data
Right 931859285 2:66337044-66337066 CTATGCTCCTTTAAATGTCCAGG No data
931859283_931859285 14 Left 931859283 2:66337007-66337029 CCGCTTAACCAAGAGTATAAAAT No data
Right 931859285 2:66337044-66337066 CTATGCTCCTTTAAATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931859285 Original CRISPR CTATGCTCCTTTAAATGTCC AGG Intergenic
No off target data available for this crispr