ID: 931862994

View in Genome Browser
Species Human (GRCh38)
Location 2:66376643-66376665
Sequence ATGAACCAACTGTCTGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931862994_931862997 7 Left 931862994 2:66376643-66376665 CCATCATCAGACAGTTGGTTCAT No data
Right 931862997 2:66376673-66376695 CATGGAGTGAATTATGAATTAGG No data
931862994_931862998 30 Left 931862994 2:66376643-66376665 CCATCATCAGACAGTTGGTTCAT No data
Right 931862998 2:66376696-66376718 AATCTATATGTAGCTATAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931862994 Original CRISPR ATGAACCAACTGTCTGATGA TGG (reversed) Intergenic
No off target data available for this crispr