ID: 931868419

View in Genome Browser
Species Human (GRCh38)
Location 2:66434930-66434952
Sequence GCGTTTGTGTGCGTGTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 387}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931868417_931868419 -7 Left 931868417 2:66434914-66434936 CCGCGGGCTACTGCCTGCGTTTG 0: 1
1: 0
2: 2
3: 5
4: 86
Right 931868419 2:66434930-66434952 GCGTTTGTGTGCGTGTGCCCTGG 0: 1
1: 0
2: 0
3: 33
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931868419 Original CRISPR GCGTTTGTGTGCGTGTGCCC TGG Intronic
900121836 1:1051594-1051616 GCCTATGTGTGCCTGTGTCCCGG + Exonic
900416407 1:2537209-2537231 GCATCTGCGTGCATGTGCCCAGG + Intergenic
900435883 1:2631045-2631067 GCACGTGTGTGCGTGTGCTCTGG + Intronic
901150500 1:7098143-7098165 GCGTGTGTGTGCATGTGCAGGGG + Intronic
901355813 1:8647663-8647685 GTGTGTGTGTGTGTGTCCCCTGG + Intronic
902402456 1:16165710-16165732 GTGTGTGTGTGTGTGTGCACAGG - Intergenic
902689836 1:18103955-18103977 GTGTCTGTGTGTGTGTGCCTGGG + Intergenic
902785114 1:18728111-18728133 GCGTGTGTCTGGGTGTCCCCTGG + Intronic
903197236 1:21699809-21699831 GTGTGTGTGTGTGTGTGGCCAGG - Intronic
903548932 1:24144070-24144092 GCCTTTGTGTGCTTGGGGCCAGG - Intergenic
904697529 1:32338599-32338621 GTGTGTGTGCGCGTGTGCCCAGG + Intergenic
905246397 1:36617430-36617452 GCGTATGTGTGCATGTCACCAGG + Intergenic
905773732 1:40654650-40654672 GAGTTTGTGTGTGTGTGGCAGGG - Intronic
909243694 1:73249408-73249430 CCCTTTGTGTGCTTATGCCCAGG + Intergenic
912435176 1:109656580-109656602 GTGTGTGTGTGCGTGCGCCGGGG + Intronic
912546618 1:110455939-110455961 GCGTGTGTGTGTGTGTGTGCAGG + Intronic
912606463 1:110994799-110994821 GTGTATGTGTGTGTGTGTCCAGG - Intergenic
913335331 1:117704274-117704296 GCATGTGTGTGCATGTGCACAGG - Intergenic
914732934 1:150388492-150388514 GTGTGTGTGTGTGTGTGCGCGGG - Intronic
914869156 1:151458910-151458932 GAGTGTGTGTGCGTGCGCCCCGG - Intronic
915835453 1:159172069-159172091 GCGTGTGTCTGCGTGTGCACCGG + Intronic
915929851 1:160053616-160053638 GTGTGTGTGTGTGTGTGTCCTGG + Intronic
916107583 1:161442445-161442467 GCGTTTGTGGGCGGGTGACGGGG - Intergenic
916109167 1:161449863-161449885 GCGTTTGTGGGCGGGTGACGGGG - Intergenic
916110754 1:161457244-161457266 GCGTTTGTGGGCGGGTGACGGGG - Intergenic
916112340 1:161464654-161464676 GCGTTTGTGGGCGGGTGACGGGG - Intergenic
916113926 1:161472035-161472057 GCGTTTGTGGGCGGGTGACGGGG - Intergenic
917254121 1:173096338-173096360 GTGTCTGTGTGTGTGCGCCCAGG + Intergenic
920033710 1:203052128-203052150 AAGTGTGTGTGCGTGTGCCTGGG + Intronic
921048497 1:211494000-211494022 TCGTCTGTGTGCTTGTTCCCTGG - Intergenic
923224920 1:231930362-231930384 GCATTTGTTTACGTGTGCCAGGG + Intronic
923518565 1:234718358-234718380 GTGTGTGTGTGTGTGTGCCGGGG + Intergenic
924539246 1:244965697-244965719 GCGTCTGAGTGCTTCTGCCCAGG + Intergenic
1062854586 10:773637-773659 GCCTGTGTGTGCCTGGGCCCCGG + Intergenic
1064245372 10:13663736-13663758 GCCTTTGTGTGTTTGTGCCCCGG + Intronic
1067068278 10:43115607-43115629 GGGTTTGTGTGAGGCTGCCCAGG + Intronic
1067783939 10:49229024-49229046 GTGTGTGTGTGTGTGTGCGCGGG + Intergenic
1069653691 10:70071087-70071109 GTGTGTGTGCGCGTGTGCACAGG + Intronic
1070147803 10:73787308-73787330 GTGTTTGTGTGTGTGTACACAGG - Intronic
1070720697 10:78754997-78755019 GTGTGTGTGTGTGTGTGTCCAGG + Intergenic
1071484185 10:86087388-86087410 GAGTCTGTGTGTGTGTGTCCGGG + Intronic
1072731707 10:97850641-97850663 GCGTGTGTGTGCGTGTGTGAGGG + Intronic
1073081560 10:100863926-100863948 GTGTGTGTGTGTGTGTGTCCAGG - Intergenic
1074779008 10:116786979-116787001 GTGTGTGTGTGTGTGTGTCCGGG - Intergenic
1076120595 10:127934019-127934041 GTGTGTGTGTGTGTGTGCGCGGG - Intronic
1076568821 10:131417916-131417938 GTGTGTGTGTGCGCGTGCACAGG - Intergenic
1076612091 10:131732560-131732582 GCATGTGTGTGTGTGTGCCTGGG - Intergenic
1076759455 10:132594511-132594533 GCGTTTGCATGCCTGTGCACGGG + Intronic
1076759468 10:132594609-132594631 GCGTTTGTGTGCCTGTGCATGGG + Intronic
1077135703 11:997258-997280 GCTGTGGTGTGCGTGTCCCCGGG + Intronic
1077223741 11:1428781-1428803 GGGTGTGTGTGCATGTGCACTGG + Intronic
1077522024 11:3042124-3042146 CCCATTGTGTGCGTGTGCCACGG + Intronic
1077887174 11:6394787-6394809 GGGTTTGGCTGCCTGTGCCCAGG + Exonic
1078374792 11:10784864-10784886 GCGTGTGTGTGCCTGTGCCTAGG + Intergenic
1078716780 11:13847297-13847319 GTGTGTGTGTGTGTGTGTCCTGG + Intergenic
1079035485 11:17015872-17015894 GTGTGTGTGTGTGTGTGGCCGGG - Intergenic
1079088951 11:17467390-17467412 GGTTTTGTTTGCTTGTGCCCAGG - Intronic
1079227139 11:18616728-18616750 GTGTGTGTGTGTGTGTGTCCAGG - Intronic
1080685389 11:34511126-34511148 GCATATGTGTGTGAGTGCCCAGG - Intronic
1081655457 11:44854209-44854231 GGGTTTGTGTGCGTGTGATGTGG + Intronic
1083617999 11:64035894-64035916 GCGGCGGGGTGCGTGTGCCCGGG - Intronic
1083795737 11:65015559-65015581 GCGTGTGTGTGTGTGTGGCGGGG + Intronic
1084594432 11:70108628-70108650 GGGTTTGTGAGCGTGTGGACAGG + Intronic
1084949235 11:72655523-72655545 GCATGTGTGTGTGTGTGCACAGG + Intronic
1085328534 11:75627478-75627500 GTCTTTGTGTGTGTGTGCTCTGG + Intronic
1087251511 11:95905326-95905348 GTGTGTGTGTGTGTGTGCGCAGG - Intronic
1088183998 11:107143186-107143208 GTGTGTGTGTGTGTGTGTCCTGG - Intergenic
1088377418 11:109158110-109158132 GTGTTTGTGTGTGTGTGGCGGGG + Intergenic
1090990026 11:131808822-131808844 GTGTGTTTGTGCGTGTGCACGGG - Intronic
1091382918 12:74451-74473 GCTGATGTGTGTGTGTGCCCGGG + Intronic
1092673036 12:10884607-10884629 GAGTTTGTGTGGGTGTGTCGGGG + Intronic
1092676683 12:10928862-10928884 GAGTTTGTGTGGGTGTGTCAGGG - Intronic
1094616177 12:32038362-32038384 GTGTCTGTGTGCCTGTGTCCTGG - Intergenic
1094698724 12:32847523-32847545 GCGTGTGTGTGTGTGTGTCAAGG - Intronic
1095812877 12:46389430-46389452 GTGTGTGTGTGTGTGTGTCCTGG - Intergenic
1097764730 12:63512528-63512550 GTGTGTGTGTGCGTGTGTGCAGG + Intergenic
1098389468 12:69953760-69953782 GTGTGTGTGTGTGTGTGTCCGGG - Intronic
1099603169 12:84767492-84767514 GCGTGTGTGTGTGTGTGTGCAGG - Intergenic
1101019911 12:100543571-100543593 GTGTGTGTGTGTGTGTGTCCAGG + Intronic
1101413455 12:104488385-104488407 GTGTATGTGTGCGTGTGTCCAGG + Intronic
1102812666 12:115837926-115837948 GTGTGTGTGTGTGTGTCCCCCGG + Intergenic
1102987711 12:117291881-117291903 GCATGTGTGTGCCTGTACCCAGG - Intronic
1103971045 12:124672194-124672216 GTGTGTGTGTGCGTGTGCGCAGG - Intergenic
1104752241 12:131247113-131247135 GTGTGTGTGTGTGTGTGTCCGGG - Intergenic
1104779681 12:131412017-131412039 GTGTGTGTGTGTGTGTGTCCGGG + Intergenic
1108082656 13:46753079-46753101 GTGTGTGTGTGTGTGTGACCGGG - Intergenic
1108614546 13:52118814-52118836 GTGTTTGTGTGTGTGTGCTGGGG - Intronic
1109063406 13:57651115-57651137 GTGTTTGTGTGCATGTGCACAGG - Intronic
1112865132 13:103886015-103886037 TCGTGTGTGTGTGTGTGCGCGGG - Intergenic
1112877786 13:104066702-104066724 GTGTATGTGTGCATGTGCACGGG - Intergenic
1112937183 13:104815692-104815714 ACGTGTGTGTGAGTGTGCCCTGG + Intergenic
1113186144 13:107687491-107687513 GTGTGTGTGTGCATGTGCACTGG - Intronic
1113602617 13:111581096-111581118 CCGTTTGTGTGCGTCTGGCCTGG + Intergenic
1113919068 13:113896164-113896186 GTGTGTGTGTGTGTGTGACCAGG + Intergenic
1114185701 14:20400296-20400318 GCGTGTGTGTGTGTGTGCAGTGG + Intronic
1115017007 14:28629555-28629577 GGGTTTGTTTGCTTTTGCCCAGG - Intergenic
1115850072 14:37584010-37584032 GCGCCTGTGTGCGGGTCCCCAGG + Intergenic
1116183839 14:41570300-41570322 GTGTTTGTGTGCATGTGCTTTGG - Intergenic
1117281854 14:54248787-54248809 GCGTGTGTGTGCATGAGCTCTGG - Intergenic
1117486013 14:56197861-56197883 GCATGTGTGTGTGTGTGCACAGG - Intronic
1117963995 14:61188638-61188660 GTGTGTGTGTGTGTGTGTCCGGG + Intronic
1118570877 14:67194437-67194459 GCGTGTGTGTGTGTGTGCTGTGG + Intronic
1119207318 14:72804176-72804198 GTGTGTGTGTGTGTGTGTCCTGG - Intronic
1119889361 14:78171344-78171366 GTGTGTGTGTGTGTGTGCGCGGG + Intergenic
1122086985 14:99314651-99314673 GTGTTTGTGTGTGTGTGGCGGGG - Intergenic
1122249849 14:100430170-100430192 GTGTGTGTGTGTGTGTTCCCGGG + Intronic
1124711906 15:32020345-32020367 GGGTGTGTGTGTGTGTGTCCAGG - Intergenic
1129892088 15:79078163-79078185 GCGTATGTGTGCACTTGCCCTGG + Intronic
1129957224 15:79650011-79650033 CCTTTTTTGTGTGTGTGCCCTGG - Intergenic
1130371062 15:83285242-83285264 GTGTGTGTGTGCGTGTGCGGTGG - Intergenic
1131553962 15:93380657-93380679 ACATGTGTGTGCGTGTGCACGGG + Intergenic
1131713750 15:95085567-95085589 GTGTGTGTGTGCGCGTGCGCAGG + Intergenic
1131749648 15:95492819-95492841 GCCTTTGTGTGAGTGTGTCTGGG - Intergenic
1132696282 16:1203487-1203509 GGGGTTGGGTGTGTGTGCCCAGG + Intronic
1133542827 16:6772967-6772989 GCATTTGTGTGCGTGTGTGTGGG + Intronic
1133606281 16:7391283-7391305 GAGTTTTTGGGCATGTGCCCTGG + Intronic
1133708008 16:8373894-8373916 GTGTGTGTGTGTGTGTGCACAGG - Intergenic
1133729797 16:8569559-8569581 CCGTGTGTGTCCGTGTGGCCTGG - Exonic
1134218120 16:12332248-12332270 GTGTTTGTGTGTGTGTGCACGGG + Intronic
1134782249 16:16908895-16908917 GTGTGTGTGTGCGTGTGTCTGGG + Intergenic
1135085013 16:19468348-19468370 GCATTTTTGTGTGTGTGCTCAGG + Intronic
1136553086 16:30992086-30992108 GTGTGTGTGTGTGTGTGTCCAGG - Exonic
1137601085 16:49756723-49756745 GCCTTTTTGCCCGTGTGCCCTGG - Intronic
1137924338 16:52525688-52525710 GCGTGTGTGTGTGTGTACGCAGG - Intronic
1138510180 16:57504137-57504159 GTGTATGTGTGTGTGTGTCCTGG + Intergenic
1139199425 16:64957595-64957617 GTGTGTGTGTGTGTGTGCACGGG - Intronic
1139350679 16:66333206-66333228 GTGTGTGTGTGTGTGTGCCCAGG - Intergenic
1140283410 16:73576390-73576412 GCATACGTGTGAGTGTGCCCGGG - Intergenic
1141983439 16:87564145-87564167 GCATTTGTGTGCGTGTGTTGGGG + Intergenic
1142514042 17:415343-415365 GTGTGTGTGTGTGTGTGTCCTGG + Intronic
1142514045 17:415399-415421 GTGTGTGTGTGTGTGTGTCCTGG + Intronic
1142975601 17:3642067-3642089 GTGTGTGTGTGTGTGTGCCTGGG + Intronic
1143516868 17:7423873-7423895 GCAGCTGTGTGCGTGAGCCCAGG + Intergenic
1143750078 17:9021558-9021580 GCGTGTGTGTGAGTGCGCGCCGG + Exonic
1143750081 17:9021584-9021606 GCGTGAGTGTGTGTGCGCCCCGG + Exonic
1143862040 17:9898016-9898038 GCATGTGTGTGTGTGTGCACAGG + Exonic
1144427353 17:15156060-15156082 GTGTGTGTGTGTGTGTGTCCAGG - Intergenic
1144754085 17:17668999-17669021 GCGTGTGCGTGTGTGTGCGCAGG - Intergenic
1144758905 17:17695976-17695998 GCCTCTTTGTGCATGTGCCCTGG - Intronic
1144762333 17:17714342-17714364 GCGTGGGTGGGCCTGTGCCCTGG + Intronic
1144892315 17:18501077-18501099 TCCTGTGTGTGCGTGGGCCCGGG - Intergenic
1145011568 17:19371249-19371271 GCTTGTGTGTACCTGTGCCCTGG + Intronic
1145139899 17:20443211-20443233 TCCTGTGTGTGCGTGGGCCCGGG + Intergenic
1145909349 17:28533532-28533554 GTGTTTGCATGAGTGTGCCCAGG - Intronic
1146925494 17:36742281-36742303 GTGTGTGTGTGTGTGTGGCCAGG + Intergenic
1147366447 17:39962671-39962693 GTGTGTGTGTGTGTGTGACCAGG - Intergenic
1147613835 17:41816955-41816977 GGGATTGTGTGCGTGTGTGCAGG + Intronic
1148331461 17:46816464-46816486 GTGTGTGTGTGCGTGTGTTCTGG - Intronic
1149990667 17:61381716-61381738 GCGTGTGTGTGCCTGTCCCCAGG + Intronic
1150291546 17:63985207-63985229 GCGTGTGTGTGTGTGTACACTGG - Intergenic
1150292518 17:63989633-63989655 GTGAATGGGTGCGTGTGCCCGGG - Intergenic
1150386743 17:64767542-64767564 GCTTTTGTATCCTTGTGCCCAGG + Intergenic
1151212282 17:72553600-72553622 GTGTGAGTGTGTGTGTGCCCAGG - Intergenic
1151212306 17:72553775-72553797 GTGTGTGTGCGTGTGTGCCCAGG - Intergenic
1151212330 17:72553985-72554007 GTGTGTGTGTGTGTGTGCCCAGG - Intergenic
1151212351 17:72554124-72554146 GTGTGTGTGTATGTGTGCCCAGG - Intergenic
1152037486 17:77882399-77882421 GTGTGTGTGTGTGAGTGCCCTGG + Intergenic
1152530154 17:80914023-80914045 GAGTGTGTGTGCATGTGCGCTGG + Intronic
1152695483 17:81741770-81741792 GAGTGTGTGTGTGTGTGACCCGG - Intergenic
1153646716 18:7202537-7202559 GTGTGTGTGTGCGTGCGCGCGGG - Intergenic
1153654902 18:7273668-7273690 GCGGTTCTGTGAGTGTGCCAGGG - Intergenic
1154285388 18:13051371-13051393 GTGTGTGTGTGCGTGTGTGCGGG + Intronic
1154300824 18:13190926-13190948 GTGTGTGTGTGCGTGTGTGCGGG + Intergenic
1154992017 18:21606489-21606511 GTGTGTGTGTGTGTGTGACCGGG + Intergenic
1155073653 18:22337206-22337228 GTGTGTGTGTGTGTGTCCCCTGG - Intergenic
1155121009 18:22818580-22818602 GTGTGTGTGTGTGTGTGACCAGG - Intronic
1156687494 18:39667697-39667719 GTGTGTGTGTGCGTGTGTGCAGG - Intergenic
1157303617 18:46499664-46499686 GTGTTTGTGTGTGTGTGGCAGGG + Intronic
1157535741 18:48456089-48456111 GCGTGTGTGTGTGTGTGTGCTGG + Intergenic
1157915360 18:51658993-51659015 GCGTTTCTGAGCAGGTGCCCAGG - Intergenic
1159944745 18:74436024-74436046 GCATGTGTGTGAGTGTGCACAGG - Exonic
1160871765 19:1281000-1281022 GCGTGTGTGTGCGGGTGCCTGGG + Intergenic
1161086255 19:2336865-2336887 GTGGGTGTGTGCGTGTGCACTGG + Intronic
1161093758 19:2376949-2376971 GCGCTGGTGTGCCTCTGCCCCGG - Intergenic
1161250681 19:3278602-3278624 GCGTGTGTGTGAGTATGCCTGGG + Intronic
1161280860 19:3444796-3444818 GCGTGTGTGTGTGTGTGCAGGGG - Intronic
1161911476 19:7197767-7197789 GTGTGTGTGTGTGTGTCCCCAGG + Intronic
1162129532 19:8517564-8517586 GTGTGTGTGTGCGTGTGTGCAGG + Intergenic
1162145215 19:8609244-8609266 GTGTGTGTGTGTGTGTACCCAGG + Intronic
1165320987 19:35084967-35084989 GTGTGTGTGTGTGTGTGCGCTGG - Intergenic
1165516588 19:36292510-36292532 CCGTCTGTGTGCGTGCGCCTCGG + Intergenic
1166464740 19:43022604-43022626 GTGTTTGTGTGTGTGTGTGCAGG + Intronic
1166536184 19:43576324-43576346 GCGTGTGTGTGTGTGTGGCAAGG - Intronic
1167566496 19:50260903-50260925 GCGTTTGTGTGCAGGGGCCCAGG + Intronic
1167650487 19:50725909-50725931 GCGTTTGTACGCGTGTACTCCGG - Intergenic
925353570 2:3220735-3220757 GCCATTGTGTGCGTGTGTTCCGG - Intronic
925353576 2:3220789-3220811 GCCATTGTGTGCGTGTGTTCCGG - Intronic
925353602 2:3221109-3221131 GCCATTGTGTGCGTGTGTTCCGG - Intronic
925353655 2:3221703-3221725 GCCATTGTGTGCGTGTGTTCCGG - Intronic
925904270 2:8529918-8529940 GTATTTGTGTGTGTGTGCGCAGG - Intergenic
926285453 2:11483718-11483740 GTGTGTGTGTGTGTGTGGCCCGG + Intergenic
926384904 2:12326488-12326510 GCGTGTGTGTGTGTGTGAGCAGG - Intergenic
927264095 2:21124742-21124764 GCGTGTGTGTGTGTGTGACAGGG + Intronic
928171344 2:29006493-29006515 GAGTGTGTGTGCGTGTGCTCAGG + Intronic
928276770 2:29908275-29908297 GTGTGTGTGTGTGTGTGCTCTGG - Intronic
928665784 2:33549363-33549385 GCGTGTGTGTGTGTGTGTGCAGG - Intronic
929007556 2:37410616-37410638 GCATGTGTGTGTGTGTGCCCAGG - Intergenic
929556420 2:42928352-42928374 GCCTTTGTGTGTGTGTGTCCAGG - Intergenic
930232193 2:48854661-48854683 GTGTGTGTGTGTGTGTGTCCTGG + Intergenic
930269545 2:49240221-49240243 GTGTTTGTGTGTGTGTGTACTGG + Intergenic
931154298 2:59609806-59609828 GTGTGTGTGTGTGTGTTCCCAGG + Intergenic
931785349 2:65613142-65613164 GTGTGTGTGTGTGTGTGTCCAGG - Intergenic
931868419 2:66434930-66434952 GCGTTTGTGTGCGTGTGCCCTGG + Intronic
934578738 2:95421033-95421055 GTGTGTGTGTGTGTGTCCCCAGG + Intergenic
934600709 2:95655670-95655692 GTGTGTGTGTGTGTGTCCCCAGG - Intergenic
936534078 2:113297794-113297816 GTGTGTGTGTGTGTGTCCCCAGG - Intergenic
937231819 2:120402471-120402493 GAGTGTGTGTGCGTGTGTGCTGG + Intergenic
937615513 2:123917444-123917466 GAGTTTGTGTGTGTGTGTGCGGG - Intergenic
939118519 2:138088792-138088814 GTGTGTGTGTGTGTGTGCACAGG - Intergenic
939618139 2:144383730-144383752 GCGCATGTGTGCGTGTGTGCAGG - Intergenic
940208165 2:151227389-151227411 GTGTGTGTGTGTGTGTGTCCAGG + Intergenic
940973021 2:159914081-159914103 GTGTGTGTGTGGGTGTGCCCTGG + Intergenic
941158276 2:162004582-162004604 GCGTGTGTGTGTGTGTGTGCAGG - Intronic
941821414 2:169847109-169847131 GTGTGTGTGTGTGTGTGCGCTGG + Intronic
942451184 2:176108681-176108703 GTGTGTGTGTGTGTGTGTCCGGG + Intronic
942660862 2:178263827-178263849 GTGTGTGTGTGCGTGTACACAGG + Intronic
942803959 2:179908119-179908141 GTGTGTGTGTGCATGTGCGCGGG + Intergenic
943836384 2:192519017-192519039 GTGTGTGTGTGTGTGTGGCCAGG - Intergenic
944046598 2:195418217-195418239 GTGTGTGTGTGTGTGTGACCAGG - Intergenic
945157242 2:206852228-206852250 TAGTTTGTGTGTGTGTGTCCTGG - Intergenic
945368119 2:208981313-208981335 GTGTGTGTGTGTGTGTTCCCAGG + Intergenic
946009919 2:216556081-216556103 GCATGTGTGTGCGTGTGCATAGG + Intronic
946177064 2:217928523-217928545 GGGCTTGGGTGTGTGTGCCCTGG - Intronic
946817704 2:223595882-223595904 GCGTGTGTGTGCGTGTGTCTGGG - Intergenic
947109416 2:226702661-226702683 GTGTTTGTGTGTGTGTGTGCCGG - Intergenic
948071752 2:235133446-235133468 GTGTGTGTGTGTGTGTGACCAGG - Intergenic
948680020 2:239627274-239627296 GTGTGTGTGTGCATGGGCCCTGG + Intergenic
1170821501 20:19758685-19758707 GGGTGTGCGTGCGTGTGCACCGG + Intergenic
1171020265 20:21578298-21578320 GCATCTGTGTGAGTGTGGCCAGG + Intergenic
1171823492 20:29875699-29875721 GTGTCCGTGTGTGTGTGCCCGGG + Intergenic
1172190415 20:33058981-33059003 GCATTTGTGTGAGTGTGCAGGGG + Intronic
1172713674 20:36947333-36947355 GTGTGTGTGTGTGTGTGTCCTGG + Intronic
1172713681 20:36947424-36947446 GTGTGTGTGTGTGTGTGTCCTGG + Intronic
1172713686 20:36947497-36947519 GTGTGTGTGTGTGTGTGTCCTGG + Intronic
1172844052 20:37919278-37919300 GCGTTTGTTTGCCTGTCCCAAGG + Intronic
1173576228 20:44114594-44114616 GTGTGTGTGTGTGTGTGCGCTGG + Intronic
1173707803 20:45125243-45125265 GTGTGTGTGTGTGTGTGACCAGG + Intergenic
1173906683 20:46634692-46634714 GTGGTTGTGGGGGTGTGCCCTGG + Intronic
1176376770 21:6090636-6090658 GCGGTTGTGGTCGAGTGCCCAGG + Intergenic
1177540001 21:22480230-22480252 GAGTTTGTGTGCGTGTGTGTGGG + Intergenic
1178843742 21:36157334-36157356 GCCTTTGTTTGCTGGTGCCCTGG + Intronic
1179565230 21:42243474-42243496 GTGTGTGTGTGTGTGTGCGCTGG + Intronic
1179707932 21:43193140-43193162 GCGTGTGTGTGTGTGTGTCTGGG - Intergenic
1179707945 21:43193384-43193406 GCGTGTGTGTGTGTGTGTCTGGG - Intergenic
1179718280 21:43301305-43301327 CCGTGTGTGGGCGTGTGCCTGGG + Intergenic
1179746705 21:43447608-43447630 GCGGTTGTGGTCGAGTGCCCAGG - Intergenic
1179914164 21:44465458-44465480 GCGTGTGTGTGTGTGTGTACAGG - Intergenic
1179999436 21:44988457-44988479 GCATGTGTGTGCGTGTGTGCGGG + Intergenic
1180157998 21:45987299-45987321 GCGTGTCTGCCCGTGTGCCCGGG + Intronic
1181392519 22:22594081-22594103 GCGTTTGTGTGTGTGTGTGGTGG - Intergenic
1181703467 22:24633932-24633954 GCGTGTGTGTGCACGTGCACTGG + Intergenic
1183034868 22:35134019-35134041 GTGTGTGTGCGCGTGTGCGCAGG + Intergenic
1184060775 22:42079726-42079748 GCGGTGGGGTGCGGGTGCCCGGG + Exonic
1184334508 22:43845291-43845313 GAGTTGGTGGGCATGTGCCCCGG - Intronic
1184923094 22:47619603-47619625 GCGTGTGTGTGTGTGTTCCTGGG + Intergenic
1185143007 22:49113804-49113826 GTGTGTGTGTGTGTGTGCACTGG - Intergenic
949665588 3:6335110-6335132 GTGTGTGTGTGCGTGTGGCAGGG + Intergenic
950138120 3:10597212-10597234 GCCTCTGTGTGTGTGTGCCTAGG - Intronic
950138134 3:10597352-10597374 GCCTCTGTGTGTGTGTGCCTAGG - Intronic
950190384 3:10972440-10972462 GCCTGTGTGTGTGTGAGCCCAGG + Intergenic
950345900 3:12292796-12292818 AGGCTTGTGTGCGTGGGCCCCGG + Intronic
952176989 3:30874942-30874964 GCAGTTGTGTGAGTGAGCCCAGG - Intronic
952389747 3:32869887-32869909 GCGTGTCTGTGCATCTGCCCGGG + Intronic
952803959 3:37328229-37328251 GTGTGTGTGTGTGTGTGTCCAGG - Intronic
952859577 3:37801878-37801900 GAGAGTGTGTGCGTGTGCCAGGG - Intronic
953743493 3:45556129-45556151 GTGTGTGTGTGCCTGTGCCCAGG + Intronic
953931520 3:47008187-47008209 GTGTGTGTATGCATGTGCCCTGG + Intronic
954796979 3:53166567-53166589 GTGTGTGTGTGAGTGTGCCATGG - Intronic
955856798 3:63280730-63280752 GTGTGTGTGTGTGTGTGCACAGG + Intronic
957163486 3:76640613-76640635 GTGTGTGTGTGTGTGTGGCCGGG + Intronic
957188810 3:76979598-76979620 GTGTGTGTGTGTGTGTGCGCAGG + Intronic
957363391 3:79188537-79188559 GTGTGTGTGTGCGTGTGCAAAGG - Intronic
957817975 3:85327549-85327571 GTGTGTGTGTGTGTGTGGCCGGG - Intronic
958166143 3:89880290-89880312 GTGTGTGTGTGCGTGTGCTGTGG + Intergenic
961564043 3:127750615-127750637 GTGTCAGTGTGCGTTTGCCCGGG - Intronic
961611933 3:128146414-128146436 GTGTCTCTGTGCGTGTGCACGGG + Intronic
961611941 3:128146530-128146552 GTGTCTCTGTGCGTGTGCACGGG + Intronic
961674571 3:128556609-128556631 GCGTCTGTGACCGTGGGCCCTGG - Intergenic
962254936 3:133864146-133864168 GTGTTTGTGTGCGTGTGTGGGGG + Intronic
962366785 3:134792113-134792135 GCGTGTGTGTGTGTGTGCAGGGG + Intronic
963741939 3:149089565-149089587 GTGTGTGTGTGTGTGTGCACGGG - Intergenic
964626535 3:158765305-158765327 GCGTGTGTGTGTGTGTGCGAGGG - Intronic
964720824 3:159765592-159765614 GCGAATGTGTGCGTGTGCATAGG - Intronic
964829049 3:160862651-160862673 GTGTGTGTGTGCGTGTGCCTAGG - Intronic
965121281 3:164560985-164561007 GCATTTGTGTGTGTGTGGCGGGG + Intergenic
965656454 3:170989875-170989897 GTGTGTGTGTGTGTGTGGCCAGG - Intergenic
965892878 3:173536765-173536787 GCGTGTGTGTGTGTGTGCGTAGG + Intronic
966008734 3:175050102-175050124 GTGTGTGTGTGAGTGTGCCCTGG + Intronic
967307790 3:188075890-188075912 GTGGTTGTGTGCGTGTGCATGGG - Intergenic
967858448 3:194134840-194134862 GTGTGTGTGTGTGTGTGTCCGGG - Intergenic
967858506 3:194135026-194135048 GAGTGTGTGTGCGCGCGCCCCGG - Intergenic
968518702 4:1025494-1025516 GTGTCTGTGTGTGTGTGTCCAGG - Exonic
968518720 4:1025724-1025746 CCGTGTGTGTGTGTGTGTCCAGG - Exonic
968518731 4:1025862-1025884 ACGTGTGTGTGTGTGTGTCCAGG - Exonic
968869239 4:3233141-3233163 GCTTTTGTCTGTGTGTGCCTAGG + Exonic
970050881 4:11913641-11913663 GTGTTTGTGTGTGTGTTCTCTGG + Intergenic
970626014 4:17883649-17883671 GCGTGTGTGTGTATGTGCACAGG - Exonic
971216124 4:24663726-24663748 GTGTGTGTGTGTGTGTGTCCAGG + Intergenic
971359951 4:25928425-25928447 GGGTTTGTGTGTGTTTGCCTTGG + Intronic
971930696 4:33078859-33078881 GTGTGTGTGTGTGTGTGGCCAGG + Intergenic
972050692 4:34729310-34729332 GGGTTTGTGTGGGATTGCCCTGG - Intergenic
972335025 4:38100115-38100137 GCGTGTGTGTGTATGTACCCAGG + Intronic
973162130 4:47032123-47032145 GTGTGTGTGTGTGTGTGCCCAGG - Intronic
977267404 4:94872079-94872101 GCTCTTGTGAGCGAGTGCCCAGG + Intronic
979469021 4:121072685-121072707 GTGTGTGTGTGCGTGCGCGCTGG - Intronic
980304132 4:131034674-131034696 GTGTGTGTGTGTGTGTGGCCGGG + Intergenic
980354686 4:131725659-131725681 GTCTGTGTGTGCGTGTGCCTTGG + Intergenic
980378491 4:131978076-131978098 GTCTGTGTGTGCGTGTGCCTTGG - Intergenic
980944878 4:139309453-139309475 GTGTGTGTGTGTGTGTGTCCAGG + Intronic
983130079 4:164007676-164007698 GTGTGTGTGTGTGTTTGCCCTGG + Intronic
985509108 5:302092-302114 GTGTGTGTGTGTGTGTGCCTTGG + Intronic
985689667 5:1300126-1300148 GGGTTAGTGTGGGTGGGCCCAGG + Intergenic
986109795 5:4702224-4702246 GTGTGTGTGTGTGTGTGCTCAGG + Intergenic
987158581 5:15116002-15116024 GCATGTGTGTGTGTGTGTCCAGG + Intergenic
987443789 5:17990680-17990702 GTGTATGTGTGCGTGTGCGTGGG + Intergenic
988671045 5:33382140-33382162 GTGTGTGTGTGTGTGTGTCCAGG + Intergenic
990872591 5:60449066-60449088 GTGTGTGTGTGTGTGTGCGCGGG - Intronic
991454177 5:66784656-66784678 TCTTTTGTGTGTGTGTGACCCGG + Intronic
993501863 5:88674651-88674673 GGGAGTGTGTGCGTGTGCGCGGG - Intergenic
994939757 5:106307362-106307384 GTGTGAGTGTGAGTGTGCCCTGG - Intergenic
996988588 5:129600208-129600230 GTGTTTGTGTGTGTGTGTACGGG - Intronic
998133267 5:139661679-139661701 GCCTGTGTGTGCCAGTGCCCTGG - Intronic
998144081 5:139716366-139716388 GTGTGTGTGTGTGTGTGTCCTGG + Intergenic
998508620 5:142692656-142692678 GCGTGTGTGTGTGTGTGTCCTGG - Intronic
999126335 5:149248855-149248877 GTGTGTGTGTGTGTGTGTCCAGG - Intronic
999304029 5:150508337-150508359 GTGTGTGTGTGTGTGTCCCCAGG + Intronic
1002351097 5:178584303-178584325 GTGTGTGTGTGTGTGTGGCCAGG - Intronic
1005868489 6:29956167-29956189 GAGTTTGTGTGCGCGAGTCCAGG - Intergenic
1006497353 6:34433362-34433384 GTGTGTGTGTGTGTGTGTCCGGG - Intergenic
1007707316 6:43798806-43798828 GCGTGTGTGTGTGTGTGCAGGGG + Intergenic
1008248645 6:49209327-49209349 GTGTGTGTGTGCGTGTGTCTGGG - Intergenic
1009555067 6:65152480-65152502 GCCCTTCTGTGCATGTGCCCTGG - Intronic
1009768230 6:68109812-68109834 GTGTGTGTGTGTGTGTGTCCAGG - Intergenic
1010375237 6:75161066-75161088 GGGTGTGTGTGTGTGTGCCTAGG - Intronic
1010658372 6:78539848-78539870 GCTTTTGTGTCGGTGTGCCTAGG + Intergenic
1012328731 6:97957996-97958018 GTGTGTGTGTGTGTGTGTCCGGG + Intergenic
1013990122 6:116244272-116244294 GCGTGTGAGTGTGTGTCCCCAGG - Exonic
1015867762 6:137744404-137744426 GTGTGTGTGTGTGTGTGCACTGG - Intergenic
1016538796 6:145139540-145139562 GCATATGTGTGCGTGAGTCCCGG + Intergenic
1016999950 6:149989708-149989730 GAGTTTCTGTGCCTGTTCCCAGG - Intergenic
1017719351 6:157234122-157234144 GCGTTTGTTTGGGTGTGTACAGG + Intergenic
1018240973 6:161774377-161774399 GTGTGTGTGTGTGTGTGCTCAGG - Intronic
1018848919 6:167573832-167573854 GCGTTTATGTGTGTGTGTCTTGG - Intergenic
1018918569 6:168154637-168154659 GCGTGTGAGTGTGTGTGCACAGG + Intergenic
1019018154 6:168895648-168895670 GTGTGTGTGTGTGTGTGTCCCGG + Intergenic
1019104815 6:169659687-169659709 GCGCTGGTGTGTGTGTGGCCTGG - Intronic
1019116416 6:169767102-169767124 GCATTTGTGTGCGTAACCCCGGG + Intronic
1019137374 6:169918884-169918906 GCGTGTGTGTACGTGTGTGCAGG + Intergenic
1019137377 6:169918964-169918986 GCGTGTGTTTGCGTGTGTGCAGG + Intergenic
1019137380 6:169919048-169919070 GTGTGTGTGTGCGTGTGTGCAGG + Intergenic
1019275999 7:176054-176076 GTGTGTGTGTGCGTGTGCACAGG + Intergenic
1019352448 7:561269-561291 GTGTGTGTGTGTGTGTGCACAGG - Intronic
1019551904 7:1607280-1607302 GCGTGTGTGTGTGTGTGACGGGG - Intergenic
1020033018 7:4946164-4946186 GCGTGTGTGTGCATGTGTGCAGG - Intronic
1020187954 7:5973176-5973198 GCGCTCGTGTGTGTGTGTCCAGG - Intergenic
1020294964 7:6751594-6751616 GCGCTCGTGTGTGTGTGTCCAGG + Intergenic
1021780621 7:24102534-24102556 GTGTTTGTGTGTGTGTGCGAGGG + Intergenic
1023081583 7:36531860-36531882 GTGTATGTGTGCGTGTGCACAGG + Intronic
1023302351 7:38786818-38786840 ATCTTTGTGTGTGTGTGCCCAGG - Intronic
1023591674 7:41787310-41787332 GGGGGTGTGTGCGTGTGCCGGGG - Intergenic
1024668324 7:51567079-51567101 GTGTGTGTGTGTGTGTGTCCTGG + Intergenic
1025295535 7:57772941-57772963 GTGTTTGTGTATGCGTGCCCTGG + Intergenic
1026795758 7:73364924-73364946 GTGTGTGTGTGTGTGTGTCCAGG + Intergenic
1029789896 7:102831390-102831412 GTGTGTGTGTGTGTGTGTCCCGG - Intronic
1030134920 7:106237482-106237504 GTGTATGTGTGTGTGTGTCCTGG + Intergenic
1032525479 7:132576295-132576317 GTGTGCGTGTGCGTGTGCCGCGG + Intronic
1033450545 7:141458863-141458885 GTGTGTGTGTGCGTGCGCACAGG - Intronic
1034959046 7:155352887-155352909 GTGTCTGTGTGTGTGTGTCCAGG + Intergenic
1034978042 7:155459170-155459192 GAGTCTTTGTGCGTGTGCGCGGG - Intronic
1035640403 8:1180737-1180759 GAGTCTGTGTGGGTGTGCCAGGG + Intergenic
1035664165 8:1368248-1368270 GCATGTGTGTGCGTGTGTGCAGG + Intergenic
1037424190 8:18737331-18737353 GTGTGTGTGTGCGTGTGACGGGG + Intronic
1037576967 8:20215433-20215455 GCCTGTCTGTGTGTGTGCCCAGG + Intronic
1037588920 8:20296727-20296749 GCATGTGTGTGCATGTGCTCTGG + Intronic
1037619196 8:20548568-20548590 GCATGTGTGTGTGTGTGTCCTGG + Intergenic
1038199299 8:25396782-25396804 GTGTGTGTGTGTGTGTGTCCCGG + Intronic
1041334103 8:56760418-56760440 CCCTTTGAGTGTGTGTGCCCCGG - Intergenic
1041766520 8:61424030-61424052 ATGTTTGTGTGCGTGTGCAAGGG - Intronic
1043475183 8:80599142-80599164 GTGTGTGTGTGTGTGTTCCCTGG - Intergenic
1044115312 8:88327801-88327823 GCGTGTGTGTGTGTGTGTCGCGG - Intronic
1046209404 8:111048002-111048024 GTGTGTGTGTGCGTGCGCACTGG + Intergenic
1047415408 8:124660932-124660954 GCGTGTGTGTACGTGTGCGTGGG - Intronic
1049188448 8:141271842-141271864 GCGTGTGTGTGTGTGTACACAGG - Intronic
1051027601 9:12631885-12631907 GTGTGTGTGTGTGTGTGCACGGG - Intergenic
1051752498 9:20357976-20357998 GTGTGTGTGTGTGTGTGCGCAGG - Intronic
1051964109 9:22804663-22804685 GTGTGTGTGTGCGTGTGCGTGGG - Intergenic
1052078245 9:24171932-24171954 GTGTTTGTGTGTGTGTGGCAGGG + Intergenic
1053749237 9:41235950-41235972 GTGTGTCTGTGTGTGTGCCCGGG - Intergenic
1054254677 9:62800799-62800821 GTGTCCGTGTGTGTGTGCCCGGG - Intergenic
1054336626 9:63814799-63814821 GTGTCCGTGTGTGTGTGCCCGGG + Intergenic
1056070611 9:82983102-82983124 GTGTGTGTGTGTGTGTGGCCTGG - Intronic
1057390412 9:94638122-94638144 TCGTTTGTGTTGGTGTGCACAGG - Intronic
1058480906 9:105394445-105394467 GTGTGTGTGTGTGTGTGTCCTGG + Exonic
1059168445 9:112100853-112100875 GTGTGTGTGTGTGTGTGTCCAGG - Intronic
1059907421 9:119003623-119003645 GAGTTTGTGTGTGTGTGGGCAGG - Intergenic
1061489874 9:130938988-130939010 GCGTGTGTGTGAGTGTGTCGGGG - Intronic
1061498791 9:130990617-130990639 GCGTGTGTGTGCGTGTGTTGTGG - Intergenic
1062419502 9:136473072-136473094 TGGTTTGTGTGCGTGTGACCAGG - Intronic
1185513455 X:680022-680044 ACGTGTGTGTGTGTGTGCACAGG + Intergenic
1185759520 X:2679570-2679592 GTGTTTGTGTGTGTGTGCACAGG + Intergenic
1185845147 X:3430863-3430885 GTGTGTGTGTGTGTGTGTCCAGG - Intergenic
1186004260 X:5051108-5051130 TTTTGTGTGTGCGTGTGCCCTGG + Intergenic
1186955256 X:14674774-14674796 GTGTTTGTGTGTGTGTGCATGGG - Intronic
1187281543 X:17861267-17861289 GCGTGTGTGCGCCTGTGTCCTGG + Exonic
1189473902 X:41334526-41334548 GCTTTTGTGTGTGCGTGCGCAGG + Intronic
1193188989 X:78547020-78547042 GTGTGTGTGTGTGTGTGTCCTGG - Intergenic
1193197366 X:78649020-78649042 GTGTGTGTGTGTGTGTGCCATGG + Intergenic
1193790521 X:85810478-85810500 GCGTGTGTGTGTGTGTGTCCAGG - Intergenic
1194570823 X:95552581-95552603 GTGTTTGTGTGTGTGTGTTCGGG - Intergenic
1194988686 X:100520771-100520793 GCGTTTGTGTGTGTGTGTTGTGG + Intergenic
1195712362 X:107783874-107783896 GTGTGTGTGTGTGTGTGTCCAGG + Intronic
1195716591 X:107824974-107824996 GCGTGTGTGTGTGTGTGCTGGGG + Intergenic
1196175348 X:112633953-112633975 GTGTTTGTGTGTGTGTGTCCAGG - Intronic
1198005092 X:132485264-132485286 ACGTGTGTGTTTGTGTGCCCAGG + Intronic
1198370532 X:135985298-135985320 GCCTGTGGGTGCGTGTGACCTGG + Intergenic
1199584911 X:149404741-149404763 GTGTGTGTGTGTGTGTCCCCAGG + Intergenic
1200085317 X:153601350-153601372 GCATGTGTGTGCGTGTGCATGGG - Intergenic
1200585646 Y:5002581-5002603 GCGTGTGTGTGTGTGTGTCGCGG + Intronic
1201065496 Y:10091339-10091361 GTGTCCGTGTGTGTGTGCCCAGG - Intergenic
1201671904 Y:16531508-16531530 GTGTGTGTGTGTGTGTGTCCAGG - Intergenic
1201745915 Y:17373318-17373340 GTGTTTGTGTGTGTGTGCAGAGG - Intergenic