ID: 931869030

View in Genome Browser
Species Human (GRCh38)
Location 2:66439848-66439870
Sequence CAGTGCTAAGAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 8, 3: 44, 4: 405}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931869030_931869034 23 Left 931869030 2:66439848-66439870 CCCTCTTCCCTCTCTTAGCACTG 0: 1
1: 0
2: 8
3: 44
4: 405
Right 931869034 2:66439894-66439916 TACTTGTACCCCCCGCGAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 13
931869030_931869038 29 Left 931869030 2:66439848-66439870 CCCTCTTCCCTCTCTTAGCACTG 0: 1
1: 0
2: 8
3: 44
4: 405
Right 931869038 2:66439900-66439922 TACCCCCCGCGAGCCGGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 59
931869030_931869036 25 Left 931869030 2:66439848-66439870 CCCTCTTCCCTCTCTTAGCACTG 0: 1
1: 0
2: 8
3: 44
4: 405
Right 931869036 2:66439896-66439918 CTTGTACCCCCCGCGAGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 24
931869030_931869037 26 Left 931869030 2:66439848-66439870 CCCTCTTCCCTCTCTTAGCACTG 0: 1
1: 0
2: 8
3: 44
4: 405
Right 931869037 2:66439897-66439919 TTGTACCCCCCGCGAGCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 27
931869030_931869035 24 Left 931869030 2:66439848-66439870 CCCTCTTCCCTCTCTTAGCACTG 0: 1
1: 0
2: 8
3: 44
4: 405
Right 931869035 2:66439895-66439917 ACTTGTACCCCCCGCGAGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931869030 Original CRISPR CAGTGCTAAGAGAGGGAAGA GGG (reversed) Exonic
901770228 1:11526443-11526465 CAAGGCTCAGAGAGGGAGGAAGG + Intronic
902769432 1:18637069-18637091 CCGTGCTAAGAATGGGGAGAGGG - Intronic
902806366 1:18863635-18863657 CAGTGCAAAGAGGGCAAAGAGGG - Intronic
902875938 1:19340856-19340878 CAGTGGAAAGAGTGGGTAGAGGG + Intronic
903173928 1:21569662-21569684 CATTGCTAAGAGAAGGCAGGGGG + Intronic
903534102 1:24055253-24055275 AAGTGTTAAGAGTGGGAGGATGG + Intergenic
903877146 1:26482756-26482778 CAGTATTAAGAAAGTGAAGAAGG - Intergenic
903974673 1:27141699-27141721 CAGTGCTCAGTCAGGGAAGCGGG + Intronic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
904862547 1:33549697-33549719 CAGTGATAAGAAAGGGAAGGAGG + Intronic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905501199 1:38439211-38439233 CAGTACAAAGAATGGGAAGAAGG - Intergenic
906037999 1:42764934-42764956 CAGTGCTTAGAGAGTAAAGAAGG - Intronic
906206188 1:43987941-43987963 GAGTGCTAAGAGAGACAAGAGGG - Intronic
906282427 1:44563408-44563430 CAGGGCCAAGGGAGGGAAGCGGG - Intronic
907871488 1:58447618-58447640 CAGTGCTATGAAAGAAAAGAAGG + Intronic
908262378 1:62349325-62349347 CACTGCTAAGTGAGAGAGGAGGG + Intergenic
908532822 1:65049794-65049816 CAATGCTAAGAGAAGGAGGCAGG - Intergenic
909278069 1:73714265-73714287 CAAAGGTGAGAGAGGGAAGAAGG + Intergenic
909569639 1:77094448-77094470 CAGTGCTAAAAGACTTAAGAAGG + Intronic
910865982 1:91788330-91788352 CAGGCCACAGAGAGGGAAGAAGG + Intronic
911119421 1:94280491-94280513 AAGTACTAAGAGATGGAAGGAGG + Intergenic
914792157 1:150887729-150887751 TAGTGCAAAGAGAGAGATGATGG - Intergenic
914984249 1:152442550-152442572 CAGTGCACTGAGCGGGAAGAGGG - Intergenic
915442690 1:155955420-155955442 CAGTGCTAAGAAATGGGAGAAGG - Intronic
915494631 1:156272991-156273013 CAGTGCTGAGATAGAGGAGAGGG - Intronic
917492933 1:175513683-175513705 CAGAGCTCTGACAGGGAAGAGGG + Intronic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
919628719 1:199938296-199938318 CATAGCTAAGTGAGGGAAAACGG - Intergenic
920308773 1:205035769-205035791 CAGAGCTAAGACTGGGAGGAAGG + Intergenic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920903573 1:210136985-210137007 CATTGCTGAGAGGGAGAAGATGG + Intronic
922008503 1:221556427-221556449 CACTGAAAAGAGAGAGAAGATGG + Intergenic
922061957 1:222101343-222101365 AAGTTCTCAGAGAGGGAAGGTGG - Intergenic
923706355 1:236347921-236347943 CAGTGCTAAGAGGGGAACCACGG - Intergenic
924219488 1:241858049-241858071 CAGTGATAAATGAGGGAATAGGG + Intronic
924258247 1:242203618-242203640 CAGTGGCAAGAGAGGGAGCAAGG - Intronic
924783485 1:247172866-247172888 CAGTGCCCAGAGAGAGAAGTGGG + Intergenic
1064317931 10:14275510-14275532 CAGTGCAAAGAAAGGGAGAAAGG + Intronic
1064695504 10:17961197-17961219 CAAGGCTAAGAGAAGGAAGGAGG + Intronic
1065553568 10:26892414-26892436 CAGCCCTCAGAGAGGGTAGATGG - Intergenic
1065599594 10:27355207-27355229 CAGCCCTCAGAGAGGGTAGATGG + Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1069735889 10:70653977-70653999 GAGTCCTAAGAGAAGGAAGGAGG + Intergenic
1070731269 10:78830157-78830179 GAGAGCTTAGAGAGGGCAGAAGG - Intergenic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1073730465 10:106281482-106281504 GAGTGAGAAGAGAGGGTAGAAGG + Intergenic
1074683123 10:115930874-115930896 AAGTGCTAACTGAGAGAAGATGG - Intronic
1076445205 10:130509579-130509601 CAGAGCTGGGAGAGGGCAGAGGG + Intergenic
1077458433 11:2695013-2695035 CAGTGGTCAGAGAGGTAAGCAGG + Intronic
1077511125 11:2963669-2963691 CAGTGCTGAGATGGGGAGGAAGG + Intronic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1079564129 11:21860135-21860157 CTGTGCTAAGAGAGAGAATATGG - Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081896063 11:46587657-46587679 AAGGGCTGACAGAGGGAAGAAGG - Intronic
1084375262 11:68772537-68772559 CAGTGCTCAGAAAAGGGAGATGG + Intronic
1084912734 11:72404265-72404287 CAGTGCCAAGAAAGGGAGGAGGG + Intronic
1085238418 11:75032623-75032645 CAGTCCTCAGAGAGTGCAGAAGG + Intergenic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1085875496 11:80402382-80402404 ATGAGCTCAGAGAGGGAAGAGGG - Intergenic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1086066879 11:82754958-82754980 CAGTGGAAAGAGTGTGAAGATGG - Intergenic
1086783327 11:90934297-90934319 CATAACTAAGAGAGGAAAGATGG + Intergenic
1087313934 11:96584191-96584213 CAGTGATAACTGAGGTAAGATGG - Intergenic
1088423056 11:109669772-109669794 CAGAGCTAAGAAAGGCAACAGGG + Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1089297554 11:117479204-117479226 CCGTGCTAAGTGGGAGAAGAAGG + Intronic
1089607062 11:119647577-119647599 AGGAGCTAGGAGAGGGAAGAGGG - Intronic
1090400363 11:126444933-126444955 CAGGCCTGAGGGAGGGAAGAAGG - Intronic
1090936120 11:131344170-131344192 CAGTGCAAACAGAGAGAAAAGGG + Intergenic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1090951041 11:131473628-131473650 CTGAGCTAGGAGAGGGAAAATGG + Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1091930077 12:4388953-4388975 TAGAGCTAAGCCAGGGAAGAGGG + Intergenic
1093650086 12:21633386-21633408 CAGAGCCAAGAGCTGGAAGAAGG - Intergenic
1093669520 12:21856967-21856989 CAGTGCTGAGAGAGGGTAGATGG - Intronic
1093836387 12:23834722-23834744 CAGTTCTTAAAGAGGTAAGAAGG + Intronic
1095968160 12:47883206-47883228 TGCTGCTAAGAGCGGGAAGACGG + Intronic
1096260425 12:50086618-50086640 CAGTGCAAAGAAAAAGAAGATGG + Exonic
1096749243 12:53748267-53748289 GAGGGCTTGGAGAGGGAAGAGGG - Intergenic
1096782159 12:53997724-53997746 CAGGCCCAAGAGAGGAAAGAAGG - Intronic
1097572639 12:61354459-61354481 CAGTTCTTTGAGAGGGAAAATGG + Intergenic
1097694730 12:62765127-62765149 CAGAGCTGAGAGAGGGAACCAGG + Intronic
1098576245 12:72046440-72046462 TACTGCTGAGAGAGGGTAGAGGG + Intronic
1099337462 12:81381525-81381547 CAGGGCCAAGAGAATGAAGATGG + Intronic
1099398469 12:82171343-82171365 CAGAGCAAAGAAAGGGAAAATGG + Intergenic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1102819365 12:115894848-115894870 CTGAGCAAAGAGAGGGAAGCAGG + Intergenic
1104068160 12:125322503-125322525 CAGAGCTGTGAGTGGGAAGAGGG + Intronic
1105959978 13:25324093-25324115 CAGTGCTTAGAGAGGTAGCAGGG + Intronic
1106159142 13:27185025-27185047 CAAGGCTATGTGAGGGAAGAGGG + Intergenic
1106559762 13:30838130-30838152 CAGTGACAAGAGTGGAAAGAAGG + Intergenic
1106647442 13:31651505-31651527 CAGGGCCATGTGAGGGAAGAGGG - Intergenic
1107890050 13:44906091-44906113 CACTGCTAAGGGGAGGAAGAAGG + Intergenic
1108677102 13:52746510-52746532 CAGAGATGAGAGAGAGAAGAAGG + Intergenic
1109237059 13:59835716-59835738 CAGTTGTAAGAGTGGGAAGTGGG - Intronic
1110200682 13:72846432-72846454 CTGTGCTAAGAGACTGGAGAGGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1114815204 14:25949290-25949312 CAGTGGTAATAGAGAGATGAAGG - Intergenic
1115133739 14:30084731-30084753 CAGTACTAAGACAGGAAATAAGG + Intronic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1116817120 14:49594458-49594480 CAGTGCTAAGAATGGAAAGGTGG + Intronic
1117709929 14:58517164-58517186 CAGTGTTAAGAGAATGAAAAAGG + Intronic
1117831206 14:59752566-59752588 AAGTGCTATGAGAATGAAGAGGG - Intronic
1118461066 14:65987501-65987523 CATTGCAAAGAGTGGGAGGAGGG + Intronic
1119176290 14:72569756-72569778 CTGAGCTAAGCAAGGGAAGATGG - Intergenic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1119796003 14:77398127-77398149 CAGTGCCAAGATAGGGAACCCGG + Intronic
1121375813 14:93410092-93410114 CACTGCTAGGTGAGGGAGGAAGG - Intronic
1125486128 15:40112094-40112116 CAGTGCTGAAAGGGGGAAAAGGG - Intergenic
1125785073 15:42309280-42309302 CAGTGCTTAGCAGGGGAAGATGG - Intronic
1126768207 15:52030153-52030175 CACTGCTAAGAGATGGGAGAAGG - Intronic
1129163420 15:73760821-73760843 CAGTACTTGGAGAGGGAAGTGGG - Intergenic
1130077854 15:80705108-80705130 AAGAGGCAAGAGAGGGAAGATGG + Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132585144 16:702896-702918 CTGAGCCAAGAGAGGGAAGGGGG + Intronic
1133023583 16:2977732-2977754 CAGTGCTAGGCGGGGGGAGAGGG - Intronic
1133524056 16:6587176-6587198 CAGTGCGGAGAGAGGGGAGCTGG - Intronic
1133862620 16:9610422-9610444 CAGAGCTCAGAGAGGCAGGAAGG + Intergenic
1133905538 16:10018877-10018899 CAGTGCTCAGATTGGGAAGGTGG - Intronic
1134297580 16:12960814-12960836 CAGGGCTGAGATAGGGAAGAAGG - Intronic
1134328477 16:13228840-13228862 GAATGATGAGAGAGGGAAGAGGG - Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1135620297 16:23950000-23950022 CAATGCAAGGAGAGGGAAGGAGG - Intronic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1136515499 16:30765893-30765915 AAGTGCTAATAAAGGGAAAAAGG - Intronic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138169139 16:54832420-54832442 CAGGGGTAAGGGTGGGAAGAAGG - Intergenic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140416692 16:74778682-74778704 CAGTCCGAAGAGAAGGGAGAGGG - Intergenic
1140720000 16:77763194-77763216 CTGGGGTAAGAGAGGGAAGGAGG - Intergenic
1141005109 16:80344701-80344723 CCGTGCTAGGAGAGGGTAGGAGG + Intergenic
1142250520 16:88989787-88989809 TAGGGCCAAGAGTGGGAAGAGGG - Intergenic
1142864227 17:2780529-2780551 CATTGCTCAGAGATGGGAGAGGG - Intronic
1143253688 17:5540518-5540540 CTTCGCTAAGAGAGGGAACAGGG + Intronic
1143260410 17:5594443-5594465 CAAGGCTAAGATAGGGAGGAGGG + Intronic
1143576770 17:7798380-7798402 CAGTGACAAGAGAGGAGAGATGG + Intronic
1143831637 17:9656675-9656697 CACAGCTAAGAGAAGGAAGCAGG - Intronic
1144083064 17:11782355-11782377 AAGATCAAAGAGAGGGAAGATGG - Intronic
1144222526 17:13112970-13112992 CAGGGCTAAGGGAGTGAAGCTGG + Intergenic
1144741444 17:17584831-17584853 CGGTGCTCAGCGAGGGGAGATGG - Intronic
1145787171 17:27601678-27601700 CACTGCTAGGAGATGGCAGAAGG + Intronic
1146430649 17:32790763-32790785 CAGGGCAAAGAGAGAGAAGAGGG + Intronic
1146432926 17:32815569-32815591 CAAATCTACGAGAGGGAAGAGGG - Intronic
1146591399 17:34131035-34131057 CAATGCTAAGGGAGAGAAAAAGG + Intronic
1146626706 17:34440388-34440410 CAGTGCTGAGAGCGGGTAGAGGG - Intergenic
1146798509 17:35800036-35800058 CAGTGCAGAGAGAGGGAGGGAGG - Intronic
1146941210 17:36845579-36845601 CAGTGCTGAGAGGAGGAAGGTGG + Intergenic
1146982610 17:37179222-37179244 CAGAGATAAGAAAGGGAAGGGGG + Intronic
1147256507 17:39185162-39185184 GATTGCCAAGAGAGGGAAGGGGG + Intronic
1147403695 17:40195692-40195714 AAGTGCTGAGGGAGGGGAGAGGG + Intergenic
1147586518 17:41656411-41656433 CATTGCTGAGAGAGGGAGAAAGG - Intergenic
1147652565 17:42070909-42070931 CAGTGCTGGGAGAGGGCAGTGGG - Intergenic
1148022256 17:44561189-44561211 CACTGTTAAGAAATGGAAGATGG - Intergenic
1149324078 17:55511974-55511996 CAGTGATAAGACAGAGAAGCAGG + Intergenic
1149520436 17:57314491-57314513 CAGTGGCAAGAGATGGAAAAGGG + Intronic
1150200663 17:63353718-63353740 GTGTGCTAAGAGAGAAAAGAGGG + Intronic
1150286237 17:63955829-63955851 CAGCACCAAGAGAGGGAAGGGGG - Intronic
1150640855 17:66948506-66948528 CAGTGCCGAGAGAGGGCAGTTGG - Intergenic
1150657197 17:67046993-67047015 CAGAGAAAAGAGAGGGAAAAAGG - Intronic
1151304677 17:73255606-73255628 CAGGGCTCAGAGAGGGGAAAAGG + Intronic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1152138100 17:78517787-78517809 CAGTTGTAAGAGAGAGAAGCTGG - Intronic
1152418092 17:80175896-80175918 CAGGGATGAGAGAGGGAAGCAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156376534 18:36519708-36519730 CTGAGGTAAGAGAGGGAAGCTGG + Intronic
1156824835 18:41418568-41418590 CAGGAATAAAAGAGGGAAGAAGG - Intergenic
1157171858 18:45414458-45414480 GACTGATGAGAGAGGGAAGAAGG - Intronic
1157386680 18:47263863-47263885 CTAGGCTGAGAGAGGGAAGAGGG - Intergenic
1158102958 18:53851401-53851423 CAGAGATGAGAGATGGAAGAAGG - Intergenic
1158249132 18:55467265-55467287 AAGTTCAAGGAGAGGGAAGATGG - Intronic
1158622178 18:59042403-59042425 CAGTGCTAAGAGGAGGAAGCAGG - Intergenic
1159088077 18:63817240-63817262 CATTGCTGAAAGAGGGAAGAGGG - Intergenic
1159306677 18:66652363-66652385 CAGTGCTGTGAGAGGGAAATGGG - Intergenic
1159995801 18:74962677-74962699 CAGCACCAGGAGAGGGAAGAGGG - Intronic
1160754495 19:750600-750622 CAGGGCTAAGAGAGGTCAGGTGG + Intergenic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1160888722 19:1365643-1365665 CAGTGCCAAGGGAGGGCGGAGGG - Intronic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161620286 19:5293719-5293741 CTGGTCTAAGAGGGGGAAGAGGG - Intronic
1162858733 19:13489666-13489688 CAGTGCTGAGAAAGGAAAGGTGG - Intronic
1164635266 19:29786957-29786979 CAGTGCTGAGACAAGGAAGGAGG + Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165074355 19:33272670-33272692 CAGTGCTAGGATAGGGATGTAGG - Intergenic
1165934921 19:39383476-39383498 CTGTGGTAAGAAAGGGAGGAAGG - Intronic
1166331703 19:42081485-42081507 CAGTGCTAAGAGGTGGAAGGTGG - Exonic
1166342870 19:42149305-42149327 CACTGCCAAGAGAAAGAAGAGGG + Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1166718699 19:44985423-44985445 CAGTGCTCAGGGAGGGGAGGTGG - Intronic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1168474673 19:56667316-56667338 TGGTGCTGAGAGAGGGAAGGAGG + Intronic
925080443 2:1059216-1059238 CAGCTCTAAGAGATGGCAGAAGG - Intronic
925888649 2:8415034-8415056 AAATCCTCAGAGAGGGAAGAAGG + Intergenic
926259274 2:11242397-11242419 CAGAGCTCAGAAAGGGAAGGAGG + Intronic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927712096 2:25332382-25332404 CAGGGCTCAGAGAAGGAAGTCGG - Intronic
927972505 2:27314769-27314791 CAGTGCTAATTGAGGGCACAGGG - Intronic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
931292273 2:60883140-60883162 CTGTACTAAGAGAATGAAGAGGG + Intronic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934884409 2:98012008-98012030 CACTGCTAATGGAGGGAGGAAGG + Intergenic
935024331 2:99261716-99261738 CAGTGCAAAGAGAGGAAGCAGGG + Intronic
936518194 2:113195805-113195827 CAGTCCAAAGACAGGGGAGAGGG - Intronic
937845943 2:126578992-126579014 CACTGCTGAGGGAGGGAGGAAGG - Intergenic
938256388 2:129862898-129862920 CAGTGCAGAGAGAGAGAAGAGGG - Intergenic
942218968 2:173750602-173750624 CAGGGCATAGAGAGGAAAGAGGG + Intergenic
943897992 2:193392243-193392265 AAGTGCTAAGAGAGTATAGAGGG - Intergenic
946367693 2:219259830-219259852 CAGTGCTGTGAGAAGGAGGATGG - Intronic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947226878 2:227849186-227849208 AATTGCTCAGAGAGGGAGGAAGG - Intergenic
948228106 2:236328654-236328676 CAAGGCTAAAAGAAGGAAGAGGG - Intronic
948251903 2:236536150-236536172 CAGGGCTGAGAGAGTGAAGTGGG + Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170481271 20:16767480-16767502 CAGTGCCAAGAAAAGGAACATGG - Intronic
1170758394 20:19225604-19225626 CAGGGTTCAGAGATGGAAGAAGG - Intronic
1171212560 20:23328003-23328025 CAGTGCAACGCAAGGGAAGAGGG + Intergenic
1172304389 20:33871018-33871040 CAAGGCCAAGTGAGGGAAGAGGG - Intergenic
1172345376 20:34194185-34194207 CAGTGCTGAGAGAGAGAACCAGG + Intergenic
1172865526 20:38094002-38094024 CAGTGCCACGACCGGGAAGATGG + Intronic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1173226272 20:41164019-41164041 CAGGGCTGGGGGAGGGAAGATGG + Intronic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1174095690 20:48087940-48087962 CAGGGCTGAGAGATGGAGGAGGG - Intergenic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1175986366 20:62765930-62765952 CGGGGCTCAGAGAGGGATGAAGG + Intergenic
1176670351 21:9728371-9728393 AAGAGCAAAGAGAGGGAAGAGGG + Intergenic
1177093542 21:16801186-16801208 TAGTACTAATAGAGGAAAGAAGG - Intergenic
1177967009 21:27740259-27740281 CAGTGGTAAGAGGGGGAGAAGGG + Intergenic
1178085428 21:29106974-29106996 GACTGCTAAGAGAAGGAAGATGG + Intronic
1179446291 21:41433215-41433237 CAGGTCTAAGAGTGGGAGGAGGG - Intronic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181525954 22:23487468-23487490 GACTGCTAAGAGAGGGAGGGAGG - Intergenic
1181776931 22:25166519-25166541 CAGGGCTGAGTGATGGAAGAAGG - Intronic
1181886878 22:26028548-26028570 GAGTGCTAGGAGAGGGAGGAAGG - Intronic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1182488425 22:30653672-30653694 CAGTGCTTAGAGAAGGGAGGCGG - Intronic
1183239022 22:36642043-36642065 CCCTGCTGAGAGAGAGAAGAGGG + Intronic
1183256972 22:36768733-36768755 CAGAGCCATGAGAGGGAAAATGG - Intronic
1183547144 22:38460369-38460391 CAGTCCTCAGCTAGGGAAGAAGG + Intergenic
1185309416 22:50145907-50145929 CAGTGCTCAGGGAGGGAGGCAGG + Intronic
949592447 3:5508640-5508662 CAGTGATAAGTGAGGGGTGATGG + Intergenic
949833985 3:8248153-8248175 CAGTACTATGAGAAGGATGAAGG - Intergenic
950906007 3:16538894-16538916 CAGAACTCAGAAAGGGAAGAAGG + Intergenic
951219816 3:20057201-20057223 CAGTGCCAACAAAGGGAATAGGG + Intronic
951467237 3:23014502-23014524 CTGTGCTCAGAGAGGTATGAAGG + Intergenic
954284191 3:49607142-49607164 CAGTGCTAAGGGAGAGATAATGG - Intronic
954718217 3:52537722-52537744 CAGTGCTGTGAGAAGGAAGTGGG + Intronic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
955235032 3:57131618-57131640 TATTGCCAAGAGAGGGATGACGG - Intronic
955359053 3:58257153-58257175 CAGCACTTAGAGAGGCAAGATGG - Intronic
955968609 3:64414079-64414101 CAGTGTTCAAAGAGGGGAGAAGG - Intronic
956039808 3:65133903-65133925 TAGAGCCAAGAGAGGGAAGGAGG - Intergenic
956050320 3:65240986-65241008 AAGTGCCAAGAAGGGGAAGACGG - Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957320104 3:78619566-78619588 TAGGGCTAAGGCAGGGAAGATGG - Intronic
957624935 3:82644380-82644402 CCATGCTAAGAGAGGAAAGGGGG - Intergenic
958921737 3:100114297-100114319 CACTGCCCGGAGAGGGAAGAGGG - Exonic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
959579098 3:107965900-107965922 GAGGGGTAAGAGAGTGAAGAGGG + Intergenic
960122198 3:113958345-113958367 CCGAGCTAGGAGAGGGAAAAAGG - Exonic
960425550 3:117502586-117502608 GATTGTTAAGAGAAGGAAGAAGG + Intergenic
960450549 3:117801568-117801590 CAGTGCTAAGAAAAGTGAGATGG - Intergenic
961595264 3:128011031-128011053 CGGTGCAAAGAAAGGGAATAAGG + Intergenic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
961978024 3:131047627-131047649 CAGGGCTGAGAGACTGAAGATGG - Intronic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
965083427 3:164064780-164064802 CTGTGCTAAGGCAGTGAAGAAGG + Intergenic
966877711 3:184332821-184332843 CAGTCCTAAGTGAGGCAAGATGG + Intronic
967367370 3:188702415-188702437 CAGTGTTCTGAGACGGAAGAAGG - Intronic
967663551 3:192143973-192143995 AAGGGATGAGAGAGGGAAGAAGG + Exonic
967727028 3:192871671-192871693 CAGAGCCAAGAGAATGAAGAGGG + Intronic
969036095 4:4255153-4255175 CAGTACTGAGAAAGGGAAGGGGG + Intergenic
969137773 4:5044428-5044450 CAGGGCAAAGGGAGGGAAGGAGG - Intergenic
969310317 4:6349160-6349182 CATTGCTGTGAGAGGGGAGAGGG - Intronic
969542925 4:7804946-7804968 CACTGCGAAGAGTGGGAAGGAGG - Intronic
970293057 4:14597587-14597609 CAGAGCTCAGAGAAGAAAGAAGG - Intergenic
972020936 4:34313196-34313218 CATGGCTAAGAGAGGGAGAAAGG + Intergenic
972710747 4:41592074-41592096 CAGTGCTATCAGAGGGAGAAGGG - Intronic
974483398 4:62475067-62475089 CAGTGCTTTCAGAGGGAACATGG - Intergenic
974976084 4:68893646-68893668 CAGACCTAATAGAGGGTAGAGGG - Intergenic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
975901145 4:79154721-79154743 AAGTGCTAGGAGAGGACAGAGGG - Intergenic
976150319 4:82084816-82084838 CACTACAAAGAGAGGGAAGGGGG + Intergenic
976591223 4:86851483-86851505 CAGTGCTGATAGAGGGGAGGGGG + Intergenic
976795367 4:88926035-88926057 GGGTGATAAGAGAGGGAGGAAGG + Intronic
977437817 4:97022381-97022403 CAGCTCTAAGACAGGGAACAAGG - Intergenic
978627837 4:110707660-110707682 GAGTAGTAAGAGAGGGTAGAGGG - Intergenic
979217142 4:118179500-118179522 AAGTGGTAAGGGAGGGAAGGTGG + Intronic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
980245241 4:130230505-130230527 CAGTGGTAAGAGGGGCCAGATGG + Intergenic
980620455 4:135294707-135294729 TTGTACTGAGAGAGGGAAGATGG - Intergenic
980646125 4:135644329-135644351 CTCTGCTAAGACAGTGAAGAAGG + Intergenic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
985295295 4:188431409-188431431 CAGGGCTGAGAGAGGGAATGGGG + Intergenic
985404426 4:189623163-189623185 AAGAGCAAAGAGAGGGAAGAGGG - Intergenic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985522074 5:378618-378640 AGGTGCTAAGAGTGGGAGGATGG + Intronic
989100159 5:37815589-37815611 CAGTGCAAAGAAAGGGACCAAGG - Intronic
989163891 5:38416296-38416318 AACTGCTAAGAGAGAGGAGACGG + Intronic
990807658 5:59684171-59684193 CAGTGCTCAGGGAGGGATGGAGG - Intronic
991017408 5:61946557-61946579 CAGAACTTGGAGAGGGAAGATGG + Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
995377073 5:111486550-111486572 AAGAGCAAAGAGAGGGAAGGGGG + Exonic
999090781 5:148934118-148934140 CCCTGCTAAGAGAAGGGAGAAGG + Intronic
999734655 5:154503824-154503846 CAATGCAAGGAGAGGAAAGAAGG + Intergenic
1000683940 5:164223727-164223749 CAGTCCCAAGAGAGGGAACTAGG + Intergenic
1001251947 5:170153348-170153370 CAGTGCTCAGAAAAGGAGGATGG - Intergenic
1001448763 5:171807845-171807867 AAATGCTAAAATAGGGAAGAGGG + Intergenic
1001600333 5:172924175-172924197 TAGTGCCCAGAGAGGGCAGAGGG - Intronic
1001835975 5:174832815-174832837 CAGTACTAAGAGAGGAATCATGG - Intergenic
1002072719 5:176689873-176689895 GAGTCCTTAGAGATGGAAGAGGG - Intergenic
1002682771 5:180981362-180981384 CACTGCTGGGAGAGGGAGGATGG + Intergenic
1003459888 6:6320019-6320041 CAGTGCTAAGGGGGAGAAGGGGG + Intronic
1003786500 6:9492878-9492900 GAGTGCTAAGCCAGGGAAGGAGG - Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004167168 6:13266966-13266988 CAGAGCTCAGGGATGGAAGAAGG - Exonic
1006021132 6:31118287-31118309 CAGTGCTGAGATAGGAAATAGGG - Intronic
1007818960 6:44545850-44545872 CAGTGGTAATAGAGGGAATCTGG - Intergenic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1010784030 6:79979030-79979052 CTGTGCTAGATGAGGGAAGATGG - Intergenic
1011216367 6:85009955-85009977 CAGTGCTCAGAGTTAGAAGATGG - Intergenic
1013273850 6:108565209-108565231 AAGTGATAAAAGAGGTAAGAAGG + Intronic
1013345178 6:109253175-109253197 GAGTGCAAAGTGAGGGAAGGTGG - Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014535098 6:122605457-122605479 AAATCCTTAGAGAGGGAAGAAGG - Intronic
1016317835 6:142809355-142809377 CAGTGCCAAGAGTGAGGAGAGGG - Intronic
1016361310 6:143270215-143270237 CTCTGCTAAGTGTGGGAAGAGGG - Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1016863633 6:148746387-148746409 CAGTGCCCAGAGAGGCAAGTGGG - Intergenic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018435608 6:163755723-163755745 AAGTGCAAAGAGAGGGAATGAGG - Intergenic
1018444517 6:163842918-163842940 CAGCTCTAAGAGAGGGAGGGAGG - Intergenic
1018472841 6:164111889-164111911 CACAGCTCAGAGAGGGAAAAGGG + Intergenic
1018674360 6:166206185-166206207 CAATGCCAGAAGAGGGAAGAGGG - Intergenic
1018725001 6:166605082-166605104 CAGTTCTAGGAGAGGCAAGAGGG - Intronic
1019287339 7:230273-230295 CAGAGCTGGGAGAGGCAAGAAGG + Intronic
1019659546 7:2216358-2216380 CACGGCTAAGAGAAGGAAGCCGG + Intronic
1020014905 7:4825184-4825206 CAGTTCTAGAAGAGGGCAGAGGG + Intronic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1021631764 7:22654592-22654614 CAGTCTTCAGAGAGAGAAGAAGG - Intergenic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1022729676 7:33010545-33010567 CATTCCTAGGAGAGGGAACAGGG - Intergenic
1024471109 7:49769573-49769595 AAGTAAGAAGAGAGGGAAGAAGG - Intergenic
1026562837 7:71464551-71464573 TTGTGCTGAGGGAGGGAAGATGG - Intronic
1027209335 7:76132281-76132303 AAGCTGTAAGAGAGGGAAGAAGG + Intergenic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1027787707 7:82600818-82600840 CAGAGCTAAAAGATGAAAGAAGG + Intergenic
1028239896 7:88406948-88406970 CAGGGCTGAGAGAGGGAGGGGGG - Intergenic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1029238142 7:99140714-99140736 CAGTGCAAAGATAGTGAAGATGG - Intronic
1032072383 7:128816247-128816269 CAGTGCCAAAAGAGGGATGAGGG - Intronic
1032076406 7:128838205-128838227 CAGTCCTGAGAGGGGGCAGAGGG - Intronic
1033733734 7:144202247-144202269 TAGTGGTAAGAGTGGTAAGATGG + Intergenic
1033749316 7:144348726-144348748 TAGTGGTAAGAGTGGTAAGATGG - Intergenic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1035664131 8:1367866-1367888 AACTGGTAAGAGAGAGAAGAGGG + Intergenic
1036617235 8:10397927-10397949 CATTAACAAGAGAGGGAAGAGGG - Intronic
1036686774 8:10917046-10917068 CTTTGCTAAGACAGGGAAGCAGG - Intronic
1037251460 8:16900159-16900181 CAATGCAAACAAAGGGAAGAAGG + Intergenic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1038546212 8:28427504-28427526 CAGAGTTAAGAGGGTGAAGAAGG - Intronic
1038698938 8:29831479-29831501 CAGAGCAAAGACAGAGAAGATGG + Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039390673 8:37178791-37178813 CAGTGCTCAGTGAAGGAGGAGGG + Intergenic
1039606449 8:38884652-38884674 CAATGCTCATAAAGGGAAGAAGG - Intergenic
1039688955 8:39841508-39841530 CAGTGCTCAGAGAGAAGAGAGGG - Intergenic
1040914295 8:52553475-52553497 CAGTCCTAAGAGAGGACATAGGG - Intronic
1041231359 8:55756539-55756561 AAGAGGAAAGAGAGGGAAGAAGG - Intronic
1043270569 8:78328743-78328765 GAGAGTTAAGAGAGGGAACATGG - Intergenic
1047703958 8:127478864-127478886 CACGTCTAAGAGAGGGGAGAAGG + Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1048477275 8:134754926-134754948 CAGAGCCAAGAGATGGGAGATGG + Intergenic
1048915144 8:139175452-139175474 TGGTGCTAAGATACGGAAGAGGG - Intergenic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1051039229 9:12785728-12785750 CACTGCTAGGAGATGGAGGAGGG + Intronic
1051155254 9:14136137-14136159 CAGTGCTAAAACAGTGAATATGG + Intronic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051616189 9:19009268-19009290 CAGAGCTAAGAAAGGTAAAAAGG + Intronic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1051729429 9:20124726-20124748 CAGACCTAAGAGAGGGAACTGGG - Intergenic
1053448844 9:38175956-38175978 TGGGGCAAAGAGAGGGAAGATGG - Intergenic
1053527885 9:38847935-38847957 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054200106 9:62072371-62072393 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054638249 9:67515989-67516011 CAGTGCTAAAACAGGGAAGAGGG + Intergenic
1055291447 9:74786121-74786143 CAGATCTAAAAGAAGGAAGAAGG + Exonic
1056150056 9:83776941-83776963 CAGTGCTATAAGAAGGAAGTAGG + Intronic
1056449723 9:86705179-86705201 CAGAGCTAAGAAAGGTAAGGCGG - Intergenic
1056456754 9:86767869-86767891 AAGGACAAAGAGAGGGAAGAGGG - Intergenic
1058552404 9:106128948-106128970 CAGAGCTACGAGATGGAGGAGGG + Intergenic
1059446361 9:114340669-114340691 CAGTGCTACTAGGGGGCAGATGG + Intronic
1060152650 9:121298788-121298810 CAGTGCTAGGAGGGAGGAGAGGG + Intronic
1060369828 9:123058038-123058060 CCGTGGAAAGAGAGGGGAGAGGG + Intronic
1060586082 9:124786909-124786931 CAGTGCTATGGCAGGGAGGAAGG - Intronic
1060591221 9:124818126-124818148 CAGAGCTCACAGAGGGGAGATGG - Intergenic
1061156194 9:128863220-128863242 CAGTGCTGAGAGACGGGGGAAGG + Intronic
1061182077 9:129030274-129030296 CAGGGCTGGGAGAGGGAACAGGG - Intergenic
1061858321 9:133455264-133455286 CACTGCCAAGAGAGGGGAGGAGG - Exonic
1062269513 9:135702184-135702206 CAGGGCAACGCGAGGGAAGAAGG + Exonic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1185688228 X:1948141-1948163 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688517 X:2133680-2133702 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186415837 X:9382422-9382444 CTGGGCTATGAGAGGGAAGTGGG - Intergenic
1187052719 X:15710387-15710409 CATTAATAAGAGAGGGAAGAAGG + Intronic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1188007589 X:25026761-25026783 CAGAGCTAAAAGAGGGCAGGTGG + Intergenic
1188792993 X:34426633-34426655 GAGTGCTAAGGCAGGGAAGGAGG - Intergenic
1189119211 X:38376053-38376075 TACTGCTAAGTGAAGGAAGAGGG + Intronic
1190711254 X:53072289-53072311 CAGAGATAAGAGAGGGTAGCTGG - Intronic
1190736995 X:53262303-53262325 CAGTGCCAATAAAGGGAAGGAGG - Intronic
1190787577 X:53666636-53666658 CACTGGTAAGAGAGGTAAGCAGG - Intronic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1192563403 X:72142687-72142709 CAGAGCTAAGAGAGAGCAGATGG - Intergenic
1192890802 X:75388991-75389013 CACTGCTAGGAGATGGGAGAGGG - Intronic
1193152605 X:78140317-78140339 CAGGGCCAAGAGAGGCTAGAGGG - Intergenic
1194366605 X:93020846-93020868 CATTCCTAGGAGAGAGAAGAAGG + Intergenic
1194606824 X:95990874-95990896 CAATGCTAATAGATTGAAGAGGG - Intergenic
1195020946 X:100827886-100827908 CAATGCAATGAGAGAGAAGATGG - Intronic
1195252081 X:103058872-103058894 CAGTGCTATTAGAGGAAACATGG - Intergenic
1197745304 X:129928774-129928796 CAATCCTAAGAGAGGGAAGGAGG + Intronic
1197962102 X:132018069-132018091 CAGACCTAAGAGAGGTAAGATGG - Intergenic
1198380321 X:136077628-136077650 CAGTTCTTAGAGAGGGAAGTGGG - Intergenic
1198671175 X:139082660-139082682 GAGAGCTTTGAGAGGGAAGATGG + Intronic
1199240959 X:145546711-145546733 CAGGGCCAAGAGGGGGAAAAGGG + Intergenic
1199334441 X:146601427-146601449 CACTGCTGAGAGATGGAAGAGGG + Intergenic
1199420923 X:147643884-147643906 CAGGGGAAAGAGAGTGAAGAGGG - Intergenic
1199836917 X:151600249-151600271 CCGTGCAAAGAGAGAGACGAGGG + Intronic
1199840281 X:151639588-151639610 AACTTCTCAGAGAGGGAAGATGG - Intronic
1199846123 X:151694286-151694308 CACTGCTAAGAGAGGGGCAAAGG - Intergenic
1200674832 Y:6137107-6137129 CATTCCTAGGAGAGAGAAGAAGG + Intergenic
1200855924 Y:7938130-7938152 CAGGGCTAAGACAGTGTAGAAGG + Intergenic