ID: 931869058

View in Genome Browser
Species Human (GRCh38)
Location 2:66440034-66440056
Sequence GCGCGCGTGTGTGTTGGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931869058_931869060 15 Left 931869058 2:66440034-66440056 CCTTCGCCAACACACACGCGCGC 0: 1
1: 0
2: 3
3: 16
4: 180
Right 931869060 2:66440072-66440094 CACACACACACACACACACACGG 0: 1789
1: 2002
2: 2702
3: 4398
4: 7597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931869058 Original CRISPR GCGCGCGTGTGTGTTGGCGA AGG (reversed) Intronic
900215627 1:1480094-1480116 GCCCGTGTGTGTGTTTGCGGCGG - Intronic
901732675 1:11291685-11291707 GCACGCGTGTGTGTTTGCATTGG + Intronic
901875980 1:12167308-12167330 GCGCGCGTGTCTGATGCGGATGG - Intronic
903476023 1:23619666-23619688 GCCCGCGTGGGCGTGGGCGAGGG + Intronic
903603314 1:24557461-24557483 GTGCGTGTGTGTGTTGGTGGTGG + Intronic
904210662 1:28885024-28885046 GTGTGTGTGTGTGTTGGCCAGGG - Intergenic
906067183 1:42989832-42989854 GCGCGCGTGTGTGTGTATGAGGG + Intergenic
915722156 1:157993529-157993551 GCGCGCGTGTGTGTGTGCAGGGG + Intronic
917081563 1:171261302-171261324 GTGCCTGTGTGTGTTGGGGAAGG - Intronic
917511380 1:175671937-175671959 GTGTGTGTGTGTGTTGGAGAGGG + Intronic
918205155 1:182301787-182301809 GCGCGCGTGCATGCTGGTGAGGG - Intergenic
919915795 1:202138286-202138308 GTGTGTGTGTGTGTTGGGGAGGG - Intronic
921790237 1:219281594-219281616 GTGTGTGTGTGTGTTGGGGAGGG - Intergenic
922381965 1:225038935-225038957 GTGTGTGTGTGTGTTGGCGAGGG - Intronic
1063084387 10:2802164-2802186 ACGTGTGTGTGTGTTGGAGAGGG - Intergenic
1064060035 10:12129622-12129644 GCGCGCGGGTCAGGTGGCGAAGG + Intronic
1064384760 10:14879613-14879635 GCGCGCGTGGGTGTGGGCGTCGG + Intronic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1066528956 10:36315323-36315345 GCGTGTGTGTGTGTTGGTTAAGG + Intergenic
1069778918 10:70942697-70942719 GTGTGTGTGTGTGTTGGGGAGGG + Intergenic
1070949206 10:80417606-80417628 GTGCCTGTGTGTGTTGGGGAAGG - Intronic
1071649145 10:87378723-87378745 GCGCGTGTGTGTGTTGGAGGAGG + Intergenic
1071995436 10:91143623-91143645 GTGTGTGTGTGTGTTGGAGATGG + Intergenic
1073147958 10:101292629-101292651 GCGCGCGTGCGTGTGCGCGGCGG - Intergenic
1073463754 10:103681737-103681759 GGGCGCGTGTGTGTGTGTGATGG - Intronic
1074088642 10:110226991-110227013 GCGCGCGTGTGTGTGAGGGGAGG + Intronic
1076683806 10:132187782-132187804 GTGCGTGTGGGTGTTGGGGAGGG - Intronic
1077158297 11:1101324-1101346 GAGGGCGTGGGTGTTGGGGAGGG - Intergenic
1077187854 11:1243458-1243480 TCGCCCGTGTGTGGTGGCCATGG - Exonic
1077898694 11:6473515-6473537 GAGCTTGTGTGTGTTGGCGGAGG - Intronic
1081750818 11:45509913-45509935 GCGCGCGTGTGTGTGTGTGCAGG + Intergenic
1082781222 11:57289016-57289038 GTGTGTGTGTGTGTTGGAGAGGG + Intergenic
1083745398 11:64733387-64733409 GTGTGTGTGTGTGTTGGTGAGGG - Intronic
1084409085 11:68995918-68995940 GTGTGTGTGTGTGTTGGGGAAGG + Intergenic
1088738502 11:112747886-112747908 GTGTGTGTGTGTGTTGGAGAGGG + Intergenic
1088935899 11:114400226-114400248 GCGGGCGTCAGCGTTGGCGATGG - Exonic
1089112879 11:116071143-116071165 GAGCGTGTGTGTGTTGGGGCGGG + Intergenic
1090178769 11:124674683-124674705 GCGTGCGTGTGTGTGAGGGAGGG - Exonic
1090833590 11:130437821-130437843 GTCCGTGTGTGTGTTGGCGGGGG - Intergenic
1091129886 11:133136863-133136885 GTGTGTGTGTGTGTTGGGGAAGG + Intronic
1091362584 11:134989432-134989454 GGGGGCGTGGGTGGTGGCGAGGG - Intergenic
1092049133 12:5455525-5455547 GTGTGTGTGTGTGTTGGGGAGGG - Intronic
1092272831 12:7037156-7037178 GTGTGTGTGTGTGTTGGCGGGGG + Intronic
1092491137 12:8946412-8946434 GAGAGAGTGTGTGTTGGGGAGGG + Intronic
1096254956 12:50057347-50057369 GCGCGCGCGTGTGTGCGCGCAGG - Intergenic
1096451591 12:51747119-51747141 GTGTGTGTGTGTGTTGGGGAGGG + Intronic
1096628037 12:52907229-52907251 GTGCGGGTGTTTGTTGGGGAGGG - Intronic
1097702696 12:62836629-62836651 GTGTGTGTGTGTGTTGGGGAGGG + Intronic
1100191222 12:92194010-92194032 CTGCGTGTGTGTGTTGGCGGGGG + Intergenic
1100954249 12:99888959-99888981 GTGTGTGTGTGTTTTGGCGAAGG - Intronic
1104923632 12:132303854-132303876 GCGAGGGTGTGTCTGGGCGAGGG - Intronic
1106278476 13:28239154-28239176 GTGTGTGTGTGTGTTGGCGGGGG - Intronic
1106557228 13:30820324-30820346 GTGTGTGTGTGTGTTGGCCAAGG + Intergenic
1109187031 13:59282145-59282167 GTGTGCGTGTGTGTTGAAGAGGG - Intergenic
1109888473 13:68575186-68575208 CCTCATGTGTGTGTTGGCGAGGG + Intergenic
1117754144 14:58956700-58956722 GCGCGCGTGTGTGTTTATGGGGG + Intergenic
1117972023 14:61261180-61261202 GTGCGTGTGTGCGTTGGTGACGG - Intronic
1119781030 14:77277069-77277091 GTGCGCGTGTGTGTATGTGAGGG - Exonic
1121674571 14:95741889-95741911 GTGTGTGTGTGTGTTGGAGAGGG + Intergenic
1122153928 14:99739142-99739164 GTGTGTGTGTGTGTTGGGGAGGG + Intronic
1122209887 14:100167224-100167246 GCGGGTGTGTGTGTTGGAGCGGG - Intergenic
1122210098 14:100168094-100168116 GGGTGCGTGTGTGTTGGGGGCGG - Intergenic
1122663151 14:103311281-103311303 GTGCGCCTGTGTGTTGGGGACGG + Intergenic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1128582292 15:68818611-68818633 GTGTGTGTGTGTGTTGGGGAGGG - Intronic
1129334373 15:74843451-74843473 GCGGGCGTGTGTGGGGGCGACGG + Intergenic
1130861216 15:87892075-87892097 GTGTGTGTGTGTGTTGGGGATGG - Intronic
1130998611 15:88920137-88920159 GTGCGTGTGTGTGTTGGGGGCGG - Intergenic
1131110413 15:89761299-89761321 GGGCATGTGTGTGTTGGGGAGGG - Intronic
1131621822 15:94075995-94076017 GTGCGCATGTGTGTTTGCTATGG - Intergenic
1134389833 16:13809094-13809116 GTGTGTGTGTGTGTTGGGGAAGG + Intergenic
1135298353 16:21302062-21302084 GGGTGTGTGTGTGTTGGCGGGGG - Intronic
1135732361 16:24905615-24905637 GCGCGCGCGTGTTTTTGAGATGG - Intronic
1137002212 16:35239064-35239086 GCACAGGTGTGTGTTGGGGATGG - Intergenic
1137784736 16:51128977-51128999 GCGCGTGTGTGTGTTAGAGTTGG + Intergenic
1141126529 16:81404552-81404574 GTGTACGTGTGTGTTGGGGAGGG - Intergenic
1142580273 17:937622-937644 GTGAGTGTGTGTGTTGGGGAGGG - Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143256687 17:5562751-5562773 GGGTGCGTGTGTGTTGGCTGGGG - Intronic
1143791437 17:9299166-9299188 GCGTGAGTGTGTGTTGGAGAAGG - Intronic
1146652083 17:34613196-34613218 GCGCGCGTGTGTGTGTGTGTGGG - Intronic
1146954257 17:36927895-36927917 GCGCGCGTGTGTGTTTGTTGGGG - Intergenic
1147257914 17:39193029-39193051 GCCCGCGTGTGTGTTGGGGTCGG - Intronic
1148330171 17:46809465-46809487 GTGTACGTGTGTGTTGGGGAGGG - Intronic
1148647735 17:49228955-49228977 GTGTGTGTGTGTGTTGGGGATGG - Intronic
1148854519 17:50571440-50571462 GTGTGGGTGTGTGTTGGAGAGGG + Intronic
1152515716 17:80822937-80822959 GCGTGTGTGTGTGTTGCTGATGG + Intronic
1155121605 18:22826499-22826521 GTGTGTGTGTGTGTTGGCGATGG + Intronic
1156008382 18:32470228-32470250 GTGCGCGCGTGTGCTGGAGAGGG - Intronic
1158964567 18:62611574-62611596 GGGCGCGTGTGTGCAGGCGCCGG - Intergenic
1160202463 18:76807020-76807042 GAGCGTGTGCGTGTTGGGGACGG - Intronic
1161022830 19:2018923-2018945 GCGTGCGTGTGTGTTAGGCAGGG - Intronic
1163427315 19:17246397-17246419 GCGCGCGTGTGTCTTGCGCAGGG - Intronic
1165716186 19:38047217-38047239 GCGTGCGTGTGTGTCGGCGGGGG - Intronic
1166963141 19:46511847-46511869 GTGTGTGTGTGTTTTGGCGATGG + Intronic
1167574660 19:50312310-50312332 GTGTGTGTGTGTGTTGGGGAGGG + Intronic
926718006 2:15940153-15940175 CCGGGGGTGTGTGTTGGGGAGGG - Intergenic
927011794 2:18911778-18911800 GCGTGTGTGTGTGTTGGTGGGGG + Intergenic
927011804 2:18911848-18911870 GAGTGTGTGTGTGTTGGTGAGGG + Intergenic
928156978 2:28885792-28885814 GTGTGTGTGTGTGTTGGCGAGGG - Intergenic
928729632 2:34216182-34216204 GTGTGTGTGTGTGTTGGGGATGG + Intergenic
931547470 2:63405573-63405595 GTGTGTGTGTGTGTTGGCGGGGG + Intronic
931869058 2:66440034-66440056 GCGCGCGTGTGTGTTGGCGAAGG - Intronic
932741600 2:74295125-74295147 GAGTGTGTGTGTGTTGGAGAGGG + Intronic
935137743 2:100322190-100322212 ACGCGCGTGGCTGCTGGCGAGGG - Exonic
936087246 2:109477630-109477652 GTGTGTGTGTGTGTTGGTGAGGG + Intronic
937212315 2:120282545-120282567 GGGTGTGTGTGTGTTGGGGAGGG + Intronic
941686918 2:168456649-168456671 GCGCGCGTGTGTGTGCGCAGGGG - Intronic
944506799 2:200420884-200420906 GTGTGTGTGTGTGTTGGCGGTGG - Intronic
945678461 2:212884113-212884135 GTGTGTGTGTGTGTTGGCAAAGG + Intergenic
946865901 2:224040284-224040306 GTGCACGTGTGTGTTGGGGAAGG + Intergenic
947049881 2:226030636-226030658 GCGCGCCTGTGTGTGGGGGGTGG + Intergenic
947746966 2:232512835-232512857 GCGCACGTGTGTGCAGGGGAGGG + Intergenic
948347224 2:237308584-237308606 ACTTGCGTGTGTGTTGGCGGGGG + Intergenic
1170428674 20:16258828-16258850 AGGGGTGTGTGTGTTGGCGATGG - Intergenic
1172587212 20:36093086-36093108 GCGCGCGTGCGTGTGTGCGCCGG + Intronic
1173726226 20:45299989-45300011 GTGTGTGTGTGTGTTGGCGTGGG + Intronic
1173865768 20:46311841-46311863 ACACGCGTGTGTGTTGGGGATGG + Intergenic
1174889867 20:54380059-54380081 GCGCACGTGTGTGTGGGGGGCGG - Intergenic
1176111532 20:63413032-63413054 GTGTGCATGTGTGTTGGGGATGG - Intronic
1176176904 20:63732376-63732398 GCGCGCATGTGTGTGGGTGAGGG + Intronic
1176176914 20:63732461-63732483 GTGCGCATGTGTGTGGGTGAGGG + Intronic
1177744748 21:25198094-25198116 GTGCTTGTGTATGTTGGCGAGGG + Intergenic
1178725464 21:35047506-35047528 GTGTGTGTGTGTGTTGGAGATGG - Intronic
1179022546 21:37653389-37653411 GCGCAGGTGTGTGGTGGCAAGGG + Intronic
1180245505 21:46544757-46544779 GGGCTCGTGTGTGGTGGTGATGG + Intronic
1182149504 22:28018287-28018309 GCGCGCGTGTGTGCGCGCGCGGG + Intronic
1182623292 22:31629525-31629547 GCGAGGGTGTGTGTAGGTGAGGG + Intronic
1183509124 22:38224904-38224926 GCCCGCGTGTCGGTGGGCGAGGG - Exonic
1184239857 22:43206392-43206414 GCACGCGTGTGTGTGTGCGGGGG - Intronic
950185191 3:10940365-10940387 ACGTGTGTGTGTGTCGGCGATGG - Exonic
952909014 3:38166133-38166155 GCGCGCCTGTGAGGTGGCGTGGG + Intronic
962690387 3:137890948-137890970 GTGTGTGTGTGTGTTGGGGAAGG + Intergenic
964626535 3:158765305-158765327 GCGTGTGTGTGTGTGTGCGAGGG - Intronic
966868435 3:184275429-184275451 GTGTGCGTGTGTGTTGGCTCTGG + Intronic
968503790 4:962864-962886 GTGCTGGTGTGTGGTGGCGATGG - Exonic
968576971 4:1371454-1371476 TTCCGCGTGTGTGTTGGAGAAGG + Intronic
969609314 4:8218136-8218158 GCACGTGTGTGTGTTGGGGGAGG + Intronic
974566412 4:63582252-63582274 GTGCGTGTGTGTGTTGGGGGGGG + Intergenic
976113620 4:81702871-81702893 GTGAGTGTGTGTGTTGGGGAAGG - Intronic
976763643 4:88576638-88576660 GCGTGTGTGTGTGTTGGGGTGGG + Intronic
978489836 4:109301583-109301605 GCGCGTGCATGTGTTGGCCAAGG - Intronic
983006987 4:162495321-162495343 GCGCGCGTGTGTGTGTGTGGTGG - Intergenic
986706869 5:10459928-10459950 CCATGTGTGTGTGTTGGCGAGGG + Intronic
987995035 5:25265263-25265285 GTGCGTGTATGTGTTGGGGAAGG - Intergenic
988777549 5:34490829-34490851 GCGCGGGGGGGTGTTGGCGGGGG + Intergenic
989033989 5:37150503-37150525 GCGCGCGTGTGTGTTGGGGGAGG - Intronic
989131352 5:38110256-38110278 GTGCGTGTGTGTGTTGAGGAAGG - Intergenic
989299600 5:39874712-39874734 GCGTGTGTGTGTATTGGCTAAGG - Intergenic
995047851 5:107670896-107670918 GTGCGTGTGTGTGGTGGCGGCGG + Intergenic
996195870 5:120606114-120606136 GGGCACGTGTGTGCTGGCAAGGG + Intronic
997237153 5:132279330-132279352 GCGCGCGTGGGTGTCGGGGGTGG - Intronic
997827170 5:137116757-137116779 GTGCATGTGTGTGTTGGGGAGGG - Intronic
999330749 5:150672009-150672031 GTGCGCGTGTGTGTTGGGGAAGG - Intronic
999536263 5:152520870-152520892 GCCCGCGTGTGTGTTGGGGAGGG + Intergenic
999882846 5:155886506-155886528 GCGTGCGTGTGTGTGTGCGTGGG + Intronic
1000785457 5:165537608-165537630 GCGCGCGTGTGTGTGTGTGATGG - Intergenic
1001820521 5:174706598-174706620 GAGTGCGTGTGTGTTGGGAAGGG - Intergenic
1004351956 6:14897999-14898021 GCGCGTGTGTGTGGTGGTGGGGG - Intergenic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1006787944 6:36680284-36680306 GCGCGCGTGCGTGTCTGCGCGGG + Intronic
1008369182 6:50714129-50714151 GCGCGTGTGTGTGGCGGCGGCGG + Intronic
1009609844 6:65927309-65927331 GCGTGCGTGTGTGTGTGTGAAGG + Intergenic
1010292075 6:74148943-74148965 GTGTGTGTGTGTGTTGGCAATGG + Intergenic
1018906919 6:168080837-168080859 GCGCTGGTGTGTGTGGGCGCTGG + Intronic
1018906928 6:168080885-168080907 GCGCTGGTGTGTGTGGGCGCTGG + Intronic
1020418135 7:7969178-7969200 GCGGGGGTGTGCGTTGGGGAGGG + Exonic
1024957059 7:54933329-54933351 CCGGGCGTGTGTGTCGGGGAGGG + Intergenic
1026217281 7:68360878-68360900 GTGCGCGTGTGTGTTCTAGAAGG + Intergenic
1026740605 7:72976195-72976217 GCCCGCGTTTGTGTTGGCAGCGG + Intergenic
1026797904 7:73377680-73377702 GCCCGCGTTTGTGTTGGCAGCGG + Intergenic
1027103127 7:75388876-75388898 GCCCGCGTTTGTGTTGGCAGCGG - Intergenic
1027861797 7:83593322-83593344 GTGTGTGTGTGTGTTGGGGAGGG + Intronic
1029707380 7:102282970-102282992 CCGAGTGTGTGTGTTGGGGAAGG - Intronic
1032651604 7:133884621-133884643 GCGCGCGTGTGTGATGGTGCTGG + Intronic
1034376661 7:150650836-150650858 GCGCGCGTGTGTGTGTATGATGG - Intergenic
1037895664 8:22652509-22652531 GTGCGCATGTGTGGTGGGGAGGG + Intronic
1038267973 8:26050647-26050669 GTGCGTGTGTGTGTTGGAGGAGG - Intergenic
1038397137 8:27254925-27254947 GCACTCGTGTGTGTAGGGGATGG + Intronic
1041864201 8:62550411-62550433 GCGCGTGTGTGTGGTGGGGGAGG + Intronic
1042722745 8:71843023-71843045 GTGTGTGTGTGTGTTGGGGAAGG - Intronic
1043284809 8:78515859-78515881 GCGTGTGTGTCTGTTGGCGGGGG + Intergenic
1045489004 8:102655377-102655399 GAGGGCGTGTGTGTTCGGGAGGG - Intronic
1045951590 8:107857486-107857508 GTGTGTGTGTGTGTTGGCAATGG + Intergenic
1048307921 8:133296649-133296671 GCGCGCGAGTGTGTAGATGAGGG - Intronic
1048308294 8:133298477-133298499 GCGCGCGTGTGTGTCTGTGGAGG - Intronic
1049032346 8:140047216-140047238 GTGCGCGTGTGTGATGTGGAAGG - Intronic
1051779935 9:20679159-20679181 GTGTGTGTGTGTGTTGGGGATGG + Intronic
1055134725 9:72814934-72814956 GTGTGTGTGTGTGTTGGGGAGGG + Intronic
1056126205 9:83538284-83538306 GCGAGCGTGTGTGTCCGCGCAGG - Exonic
1057489405 9:95509588-95509610 GCGCGCGTGTGTGCGCGCAAAGG - Intronic
1057714853 9:97484461-97484483 GTGTGTGTGTGTGTTGGGGAGGG - Intronic
1057950818 9:99367953-99367975 GTGTGTGTGTGTGTTGGGGAAGG - Intergenic
1060469034 9:123931870-123931892 GTGTGTGTGTGTGTTGGAGAGGG + Intergenic
1061589025 9:131586189-131586211 GCGTGTGTGTGTGTTTGAGACGG - Intronic
1189192535 X:39122923-39122945 GTGTGTGTGTGTGTTGGGGATGG - Intergenic
1189216788 X:39332154-39332176 GGGTGGGTGTGTGTTGGCGGGGG - Intergenic
1192546143 X:72016653-72016675 GTGTGTGTGTGTGTTGGGGATGG - Intergenic
1195316849 X:103687507-103687529 GCGCGCGTGCGTGATGGTGGGGG + Intronic
1198094351 X:133363835-133363857 GCTGGTGTGTGTGTTGGGGAAGG - Intronic